Mutagenetix > Incidental Mutation

Incidental Mutation 'R1481:Lamc1'

164345

Institutional Source

Beutler Lab

Gene Symbol

Lamc1

Ensembl Gene

ENSMUSG00000026478

Gene Name

laminin, gamma 1

Synonyms

laminin B2, Lamb2

MMRRC Submission

039534-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R1481 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

153218922-153332786 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 153221634 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Lysine to Glutamic Acid at position 1555 (K1555E)

Ref Sequence

ENSEMBL: ENSMUSP00000027752 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000027752]

AlphaFold

no structure available at present

Predicted Effect

probably damaging
Transcript: ENSMUST00000027752
AA Change: K1555E

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000027752
Gene: ENSMUSG00000026478
AA Change: K1555E

Domain	Start	End	E-Value	Type
signal peptide	1	33	N/A	INTRINSIC
LamNT	42	282	1.97e-150	SMART
EGF_Lam	284	337	7.18e-7	SMART
EGF_Lam	340	393	7.93e-9	SMART
EGF_Lam	396	440	2.11e-13	SMART
EGF_Lam	443	490	2.87e-15	SMART
LamB	551	676	5.52e-48	SMART
Pfam:Laminin_EGF	683	718	1.3e-4	PFAM
EGF_Lam	722	768	2.38e-12	SMART
EGF_Lam	771	823	1.39e-4	SMART
EGF_Lam	826	879	8.05e-10	SMART
EGF_Lam	882	930	8.9e-12	SMART
EGF_Lam	933	978	1.26e-11	SMART
EGF_Lam	981	1026	7.4e-9	SMART
coiled coil region	1063	1594	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000161744

SMART Domains

Protein: ENSMUSP00000124662
Gene: ENSMUSG00000026478

Domain	Start	End	E-Value	Type
coiled coil region	1	73	N/A	INTRINSIC

Meta Mutation Damage Score

0.1037

Coding Region Coverage

1x: 99.1%
3x: 98.3%
10x: 96.3%
20x: 92.6%

Validation Efficiency

100% (71/71)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Laminins, a family of extracellular matrix glycoproteins, are the major noncollagenous constituent of basement membranes. They have been implicated in a wide variety of biological processes including cell adhesion, differentiation, migration, signaling, neurite outgrowth and metastasis. Laminins, composed of 3 non identical chains: laminin alpha, beta and gamma (formerly A, B1, and B2, respectively), have a cruciform structure consisting of 3 short arms, each formed by a different chain, and a long arm composed of all 3 chains. Each laminin chain is a multidomain protein encoded by a distinct gene. Several isoforms of each chain have been described. Different alpha, beta and gamma chain isomers combine to give rise to different heterotrimeric laminin isoforms which are designated by Arabic numerals in the order of their discovery, i.e. alpha1beta1gamma1 heterotrimer is laminin 1. The biological functions of the different chains and trimer molecules are largely unknown, but some of the chains have been shown to differ with respect to their tissue distribution, presumably reflecting diverse functions in vivo. This gene encodes the gamma chain isoform laminin, gamma 1. The gamma 1 chain, formerly thought to be a beta chain, contains structural domains similar to beta chains, however, lacks the short alpha region separating domains I and II. The structural organization of this gene also suggested that it had diverged considerably from the beta chain genes. Embryos of transgenic mice in which both alleles of the gamma 1 chain gene were inactivated by homologous recombination, lacked basement membranes, indicating that laminin, gamma 1 chain is necessary for laminin heterotrimer assembly. It has been inferred by analogy with the strikingly similar 3' UTR sequence in mouse laminin gamma 1 cDNA, that multiple polyadenylation sites are utilized in human to generate the 2 different sized mRNAs (5.5 and 7.5 kb) seen on Northern analysis. [provided by RefSeq, Aug 2011]
PHENOTYPE: Embryos homozygous for a targeted null mutation lack development of basement membranes, migration of primitive endoderm cells out of the inner cell mass, and parietal yolk sac development, resulting in lethality by embryonic day 5.5. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 68 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4932438A13Rik	T	C	3: 37,008,434	V3365A	probably damaging	Het
Arhgef5	A	G	6: 43,274,634	H773R	probably damaging	Het
Bmp3	G	A	5: 98,872,470	V251M	probably damaging	Het
Ccdc175	C	A	12: 72,101,948		probably benign	Het
Ccdc178	C	T	18: 22,105,621	G313D	probably benign	Het
Cd300ld2	T	A	11: 115,012,633	I129F	probably benign	Het
Cep170	T	C	1: 176,782,385	Q120R	possibly damaging	Het
Ckb	T	C	12: 111,671,262	H145R	probably benign	Het
Cntnap5a	T	A	1: 116,117,663	N336K	probably damaging	Het
Coil	T	A	11: 88,974,060	C38S	possibly damaging	Het
Cps1	T	C	1: 67,143,882	V133A	probably damaging	Het
Cspg4	A	G	9: 56,887,810	E943G	probably damaging	Het
Cyp2c54	C	T	19: 40,047,588	D293N	probably benign	Het
Cyp2f2	T	C	7: 27,121,877	S72P	probably benign	Het
Dip2c	G	A	13: 9,551,866		probably null	Het
Dock6	T	C	9: 21,820,622	T1158A	probably benign	Het
Dscaml1	G	A	9: 45,672,643	V469I	probably benign	Het
Efcab14	A	G	4: 115,756,517	T221A	probably benign	Het
Ehbp1	T	C	11: 22,006,782	*1207W	probably null	Het
Eln	T	C	5: 134,706,572	K786E	probably damaging	Het
Fyb	C	T	15: 6,619,647	P385S	probably benign	Het
Galr1	A	G	18: 82,405,741	I137T	possibly damaging	Het
Gcm1	A	T	9: 78,059,717	K73*	probably null	Het
Gemin5	T	C	11: 58,141,654	N775D	probably damaging	Het
Gli3	C	T	13: 15,613,850	H147Y	probably damaging	Het
Gm10754	G	T	10: 97,682,227		probably benign	Het
Gpr37	T	C	6: 25,669,138	D569G	probably damaging	Het
Grina	T	A	15: 76,249,089	Y286N	probably damaging	Het
Gtf3c1	C	A	7: 125,693,138		probably null	Het
Kcnc4	C	T	3: 107,448,218	V305M	probably benign	Het
Kntc1	T	C	5: 123,778,275	F724L	probably benign	Het
Kpnb1	T	C	11: 97,178,310	Y249C	probably damaging	Het
Krt6b	T	C	15: 101,678,374	T269A	probably benign	Het
Maneal	T	C	4: 124,861,857	Y104C	probably damaging	Het
Map1b	T	C	13: 99,431,171	T1681A	unknown	Het
Mettl17	T	C	14: 51,890,703	L272P	probably benign	Het
Mib2	T	A	4: 155,656,999	S357C	probably benign	Het
Mmp19	C	A	10: 128,798,178	T316K	possibly damaging	Het
Mroh9	C	T	1: 163,026,509	G774E	probably damaging	Het
Myh1	T	C	11: 67,205,499		probably benign	Het
Ncor2	C	A	5: 125,027,138	E963*	probably null	Het
Nol6	T	A	4: 41,123,596	T51S	probably benign	Het
Nsun3	A	T	16: 62,735,369	C265S	probably damaging	Het
Nup214	C	T	2: 32,034,466	S1669F	probably damaging	Het
Nutm2	T	A	13: 50,469,481	N71K	probably damaging	Het
Olfr498	C	T	7: 108,465,960	T212I	probably benign	Het
Olfr713	T	G	7: 107,036,149	L5R	probably benign	Het
Orc3	T	A	4: 34,607,228	E34V	possibly damaging	Het
Pcdhb13	T	A	18: 37,442,836	L89Q	probably damaging	Het
Polr3a	A	T	14: 24,452,548	V1241E	probably null	Het
Prpf39	C	T	12: 65,053,314	P135S	probably damaging	Het
Psrc1	T	C	3: 108,384,993	V34A	probably benign	Het
Rab27a	G	A	9: 73,082,402	V52M	probably benign	Het
Rassf9	A	G	10: 102,546,034	T424A	probably benign	Het
Ripor3	G	T	2: 168,000,377	R61S	possibly damaging	Het
Ryr3	C	T	2: 112,636,522		probably benign	Het
Samd4b	C	T	7: 28,414,010	G177R	probably damaging	Het
Setbp1	C	T	18: 78,783,301	V1366M	probably benign	Het
Smad1	G	A	8: 79,343,730	A393V	probably benign	Het
Tctn2	T	C	5: 124,607,763		noncoding transcript	Het
Tmem45a	A	T	16: 56,811,602	F218I	possibly damaging	Het
Tpte	A	T	8: 22,355,471	R512S	probably damaging	Het
Trim37	T	A	11: 87,129,759	L22*	probably null	Het
Ttc6	A	G	12: 57,737,130	N1792D	probably damaging	Het
Ttn	A	G	2: 76,945,616	M1694T	probably damaging	Het
Vmn1r181	T	A	7: 23,984,712	W201R	probably damaging	Het
Wdr74	C	T	19: 8,738,228	L198F	possibly damaging	Het
Zfp560	T	C	9: 20,348,790	T259A	probably benign	Het

Other mutations in Lamc1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00950:Lamc1	APN	1	153240495	missense	probably damaging	1.00
IGL01397:Lamc1	APN	1	153251134	missense	probably damaging	1.00
IGL01661:Lamc1	APN	1	153221573	missense	possibly damaging	0.89
IGL01894:Lamc1	APN	1	153247082	missense	possibly damaging	0.51
IGL02000:Lamc1	APN	1	153240433	missense	probably damaging	1.00
IGL02649:Lamc1	APN	1	153247042	missense	possibly damaging	0.78
IGL02749:Lamc1	APN	1	153249853	missense	possibly damaging	0.51
IGL02819:Lamc1	APN	1	153250661	missense	probably damaging	1.00
IGL02831:Lamc1	APN	1	153247055	missense	probably benign	0.00
IGL03069:Lamc1	APN	1	153239381	missense	probably damaging	1.00
IGL03143:Lamc1	APN	1	153332274	missense	probably benign	0.00
IGL03166:Lamc1	APN	1	153332301	missense	probably benign	0.01
IGL03285:Lamc1	APN	1	153227685	missense	possibly damaging	0.96
IGL03294:Lamc1	APN	1	153262646	missense	probably damaging	1.00
pride	UTSW	1	153247284	missense	probably benign	0.01
Stratum	UTSW	1	153251124	nonsense	probably null
tier	UTSW	1	153250522	missense	probably damaging	1.00
PIT4280001:Lamc1	UTSW	1	153243471	missense	probably damaging	1.00
R0003:Lamc1	UTSW	1	153262439	missense	probably damaging	0.99
R0003:Lamc1	UTSW	1	153262439	missense	probably damaging	0.99
R0027:Lamc1	UTSW	1	153262583	missense	probably damaging	1.00
R0060:Lamc1	UTSW	1	153241868	unclassified	probably benign
R0078:Lamc1	UTSW	1	153229190	missense	probably damaging	0.96
R0157:Lamc1	UTSW	1	153262607	missense	probably benign	0.00
R0282:Lamc1	UTSW	1	153255312	missense	probably benign
R0374:Lamc1	UTSW	1	153251065	splice site	probably benign
R0494:Lamc1	UTSW	1	153246936	critical splice donor site	probably null
R0502:Lamc1	UTSW	1	153246932	splice site	probably benign
R0755:Lamc1	UTSW	1	153247450	missense	possibly damaging	0.94
R0791:Lamc1	UTSW	1	153234580	missense	possibly damaging	0.94
R0791:Lamc1	UTSW	1	153234595	missense	probably damaging	1.00
R0791:Lamc1	UTSW	1	153234612	missense	probably benign	0.01
R0792:Lamc1	UTSW	1	153234580	missense	possibly damaging	0.94
R0792:Lamc1	UTSW	1	153234595	missense	probably damaging	1.00
R0792:Lamc1	UTSW	1	153234612	missense	probably benign	0.01
R0892:Lamc1	UTSW	1	153332254	missense	possibly damaging	0.95
R0941:Lamc1	UTSW	1	153332274	missense	possibly damaging	0.72
R0961:Lamc1	UTSW	1	153221646	frame shift	probably null
R0961:Lamc1	UTSW	1	153221700	missense	probably benign	0.03
R0963:Lamc1	UTSW	1	153243386	missense	probably benign
R1127:Lamc1	UTSW	1	153250459	missense	possibly damaging	0.69
R1173:Lamc1	UTSW	1	153247231	splice site	probably benign
R1175:Lamc1	UTSW	1	153247231	splice site	probably benign
R1449:Lamc1	UTSW	1	153250495	missense	probably benign
R1565:Lamc1	UTSW	1	153242743	missense	probably benign	0.34
R1583:Lamc1	UTSW	1	153243478	critical splice acceptor site	probably null
R1643:Lamc1	UTSW	1	153258072	splice site	probably benign
R1652:Lamc1	UTSW	1	153249646	missense	probably damaging	1.00
R1691:Lamc1	UTSW	1	153247249	missense	probably benign	0.04
R1854:Lamc1	UTSW	1	153249872	missense	probably damaging	0.99
R2018:Lamc1	UTSW	1	153242632	missense	probably benign	0.07
R2170:Lamc1	UTSW	1	153249142	missense	probably benign	0.07
R2410:Lamc1	UTSW	1	153247395	missense	possibly damaging	0.61
R3438:Lamc1	UTSW	1	153226415	missense	probably benign	0.04
R3615:Lamc1	UTSW	1	153251150	missense	probably damaging	1.00
R3616:Lamc1	UTSW	1	153251150	missense	probably damaging	1.00
R3699:Lamc1	UTSW	1	153255205	missense	possibly damaging	0.79
R3811:Lamc1	UTSW	1	153262708	splice site	probably null
R4285:Lamc1	UTSW	1	153234552	missense	probably damaging	0.99
R4431:Lamc1	UTSW	1	153221528	missense	probably damaging	1.00
R4579:Lamc1	UTSW	1	153247269	missense	probably damaging	1.00
R4625:Lamc1	UTSW	1	153242696	missense	probably benign	0.04
R4649:Lamc1	UTSW	1	153228777	missense	probably damaging	0.99
R4650:Lamc1	UTSW	1	153228777	missense	probably damaging	0.99
R4651:Lamc1	UTSW	1	153228777	missense	probably damaging	0.99
R4652:Lamc1	UTSW	1	153228777	missense	probably damaging	0.99
R4653:Lamc1	UTSW	1	153228777	missense	probably damaging	0.99
R4784:Lamc1	UTSW	1	153231740	missense	probably damaging	1.00
R4785:Lamc1	UTSW	1	153231740	missense	probably damaging	1.00
R4853:Lamc1	UTSW	1	153229100	missense	possibly damaging	0.89
R5216:Lamc1	UTSW	1	153227696	missense	probably damaging	1.00
R5217:Lamc1	UTSW	1	153227696	missense	probably damaging	1.00
R5218:Lamc1	UTSW	1	153227696	missense	probably damaging	1.00
R5219:Lamc1	UTSW	1	153227696	missense	probably damaging	1.00
R5468:Lamc1	UTSW	1	153233564	missense	probably damaging	0.99
R5597:Lamc1	UTSW	1	153251970	missense	probably damaging	1.00
R5754:Lamc1	UTSW	1	153247284	missense	probably benign	0.01
R6233:Lamc1	UTSW	1	153223666	missense	probably benign
R6431:Lamc1	UTSW	1	153221671	missense	probably benign	0.21
R6636:Lamc1	UTSW	1	153241975	missense	possibly damaging	0.93
R6888:Lamc1	UTSW	1	153262492	missense	probably damaging	1.00
R7161:Lamc1	UTSW	1	153226454	missense	probably damaging	1.00
R7240:Lamc1	UTSW	1	153234650	missense	possibly damaging	0.82
R7388:Lamc1	UTSW	1	153249076	missense	probably damaging	1.00
R7474:Lamc1	UTSW	1	153332265	missense	possibly damaging	0.81
R7570:Lamc1	UTSW	1	153243275	missense	possibly damaging	0.64
R7583:Lamc1	UTSW	1	153243232	missense	possibly damaging	0.71
R7597:Lamc1	UTSW	1	153240454	missense	possibly damaging	0.94
R7635:Lamc1	UTSW	1	153249060	missense	probably damaging	1.00
R7976:Lamc1	UTSW	1	153247268	missense	probably damaging	1.00
R8012:Lamc1	UTSW	1	153221612	missense	probably benign	0.04
R8207:Lamc1	UTSW	1	153250522	missense	probably damaging	1.00
R8219:Lamc1	UTSW	1	153247327	missense	probably damaging	1.00
R8227:Lamc1	UTSW	1	153223754	missense	probably benign	0.04
R8315:Lamc1	UTSW	1	153243421	missense	probably benign	0.00
R8417:Lamc1	UTSW	1	153230769	missense	probably damaging	1.00
R8685:Lamc1	UTSW	1	153233542	missense	probably benign	0.31
R8827:Lamc1	UTSW	1	153221678	missense	probably damaging	1.00
R8995:Lamc1	UTSW	1	153332247	missense	probably benign	0.00
R9061:Lamc1	UTSW	1	153251124	nonsense	probably null
R9141:Lamc1	UTSW	1	153247450	missense	probably benign	0.01
R9187:Lamc1	UTSW	1	153221688	nonsense	probably null
R9206:Lamc1	UTSW	1	153250451	missense	probably damaging	1.00
R9222:Lamc1	UTSW	1	153243341	missense	probably damaging	0.96
R9297:Lamc1	UTSW	1	153252000	missense	probably damaging	1.00
R9318:Lamc1	UTSW	1	153252000	missense	probably damaging	1.00
R9377:Lamc1	UTSW	1	153239263	missense	probably benign

Predicted Primers

PCR Primer
(F):5'- ATCTTTGTGTCAAGGCACCGAGGC -3'
(R):5'- CACCTTCTTCAGCATAAGCGAGGTC -3'

Sequencing Primer
(F):5'- TGTCAGGGACACTGCCTTAC -3'
(R):5'- ccaagttggacaacccgag -3'

Posted On

2014-03-28