Incidental Mutation 'R1531:Hk1'
ID166221
Institutional Source Beutler Lab
Gene Symbol Hk1
Ensembl Gene ENSMUSG00000037012
Gene Namehexokinase 1
SynonymsmHk1-s, Hk-1, Hk1-s
MMRRC Submission 039570-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.554) question?
Stock #R1531 (G1)
Quality Score225
Status Not validated
Chromosome10
Chromosomal Location62268855-62379908 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 62284784 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Cysteine at position 545 (R545C)
Ref Sequence ENSEMBL: ENSMUSP00000118601 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000072357] [ENSMUST00000099691] [ENSMUST00000116238] [ENSMUST00000130422]
Predicted Effect probably benign
Transcript: ENSMUST00000072357
AA Change: R573C

PolyPhen 2 Score 0.020 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000072195
Gene: ENSMUSG00000037012
AA Change: R573C

DomainStartEndE-ValueType
Pfam:Hexokinase_1 25 224 1.2e-70 PFAM
Pfam:Hexokinase_2 229 486 8e-79 PFAM
Pfam:Hexokinase_1 496 695 7e-76 PFAM
Pfam:Hexokinase_2 700 934 4.2e-85 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000099691
AA Change: R546C

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000097282
Gene: ENSMUSG00000037012
AA Change: R546C

DomainStartEndE-ValueType
Pfam:Hexokinase_1 16 221 1.9e-86 PFAM
Pfam:Hexokinase_2 223 462 1e-102 PFAM
Pfam:Hexokinase_1 464 669 1.1e-90 PFAM
Pfam:Hexokinase_2 671 910 2.2e-109 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000116238
AA Change: R573C

PolyPhen 2 Score 0.020 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000111946
Gene: ENSMUSG00000037012
AA Change: R573C

DomainStartEndE-ValueType
Pfam:Hexokinase_1 21 225 1.3e-85 PFAM
Pfam:Hexokinase_2 227 357 3.6e-56 PFAM
Pfam:Hexokinase_2 362 489 9.3e-41 PFAM
Pfam:Hexokinase_1 491 696 2e-90 PFAM
Pfam:Hexokinase_2 698 937 3.8e-109 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000130422
AA Change: R545C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000118601
Gene: ENSMUSG00000037012
AA Change: R545C

DomainStartEndE-ValueType
Pfam:Hexokinase_1 16 220 1.4e-85 PFAM
Pfam:Hexokinase_2 222 461 1e-102 PFAM
Pfam:Hexokinase_1 463 668 1.1e-90 PFAM
Pfam:Hexokinase_2 670 909 2.2e-109 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000161160
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.1%
  • 10x: 95.6%
  • 20x: 90.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Hexokinases phosphorylate glucose to produce glucose-6-phosphate, the first step in most glucose metabolism pathways. This gene encodes a ubiquitous form of hexokinase which localizes to the outer membrane of mitochondria. Mutations in this gene have been associated with hemolytic anemia due to hexokinase deficiency. Alternative splicing of this gene results in several transcript variants which encode different isoforms, some of which are tissue-specific. [provided by RefSeq, Apr 2016]
PHENOTYPE: Homozygous mutant mice exhibit hemolytic anemia with extensive tissue iron deposition and reticulocytosis and female infertility. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 85 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700021F05Rik A G 10: 43,525,320 V211A probably benign Het
Agtpbp1 T A 13: 59,500,634 probably null Het
Aldh3b2 T G 19: 3,977,543 F28C probably damaging Het
Apaf1 T C 10: 91,054,521 N540S probably damaging Het
Apob T C 12: 7,997,880 I953T possibly damaging Het
Arhgef1 A G 7: 24,924,998 T816A probably damaging Het
Arid4a T A 12: 71,076,005 F1053L probably benign Het
Atxn1l A C 8: 109,732,059 F524V probably damaging Het
Cad T A 5: 31,076,219 M1874K probably benign Het
Ccdc40 G A 11: 119,263,189 V1096I probably benign Het
Ccdc93 A G 1: 121,480,822 D358G probably benign Het
Cd96 T C 16: 46,117,806 T99A probably benign Het
Cdc42ep3 A T 17: 79,335,044 M149K probably benign Het
Cog4 A G 8: 110,879,721 E613G probably benign Het
Crebbp A T 16: 4,084,517 I2286N probably benign Het
Csf1 T C 3: 107,748,338 E459G possibly damaging Het
Csrp2 A T 10: 110,935,205 Y57F probably benign Het
Ctdspl C T 9: 119,040,582 P244L probably damaging Het
Cyp2c29 A G 19: 39,324,968 R303G probably damaging Het
Cyp4a10 C A 4: 115,518,435 Y38* probably null Het
Dmgdh T A 13: 93,744,411 I783N probably damaging Het
Efcc1 G A 6: 87,731,166 E92K probably benign Het
Eif2ak4 T A 2: 118,443,210 L872H probably damaging Het
Elp2 T A 18: 24,631,404 S603T probably benign Het
Eml2 T A 7: 19,196,254 L300H probably damaging Het
Esp3 A G 17: 40,635,936 K50R possibly damaging Het
Esrp1 A G 4: 11,379,375 F136L probably damaging Het
Exoc1 T A 5: 76,559,164 D497E probably damaging Het
Fat3 A G 9: 15,997,465 S2414P probably damaging Het
Foxj3 C T 4: 119,620,201 P369S unknown Het
Gkn2 G T 6: 87,375,939 probably null Het
Gm17333 AAGAAGAGAAGAGAAGAGAAGAGAAGAGAAGAGAA AAGAAGAGAAGAGAAGAGAAGAGAAGAGAA 16: 77,852,878 noncoding transcript Het
Gm21905 A T 5: 67,946,381 probably benign Het
Grhl1 T A 12: 24,582,963 probably null Het
Grk6 A G 13: 55,452,154 Y221C probably damaging Het
Hcrtr1 T A 4: 130,130,927 K389* probably null Het
Hsp90b1 A T 10: 86,696,795 I339N probably benign Het
Ikzf3 T C 11: 98,490,446 R103G probably damaging Het
Itgad A C 7: 128,178,370 I141L probably benign Het
Jmjd6 T A 11: 116,842,440 Y137F probably benign Het
Kcna1 A G 6: 126,642,067 V430A probably benign Het
Kel A G 6: 41,688,626 V520A probably damaging Het
Klhl41 G A 2: 69,670,740 V182I probably benign Het
Ldhb C A 6: 142,501,395 M64I probably benign Het
Lrrc23 A G 6: 124,776,114 S190P possibly damaging Het
Mb21d1 A G 9: 78,442,481 Y200H probably damaging Het
Mboat2 T C 12: 24,959,030 V445A probably benign Het
Mlycd G A 8: 119,401,519 W188* probably null Het
Mpp3 C T 11: 102,008,649 E349K probably benign Het
Myh4 A G 11: 67,250,540 M780V probably benign Het
Myh6 G A 14: 54,956,506 R809C probably damaging Het
Mylip G A 13: 45,406,570 V161M possibly damaging Het
Nrp1 G A 8: 128,425,969 V220I probably null Het
Nup210 A T 6: 91,034,841 N455K probably benign Het
Olfr116 A T 17: 37,624,352 Y94* probably null Het
Olfr583 C A 7: 103,051,588 Q97K probably benign Het
Pbld2 G T 10: 63,053,953 probably null Het
Pclo C G 5: 14,521,903 P434R probably damaging Het
Pdlim3 A G 8: 45,896,763 K37E probably damaging Het
Prkdc T A 16: 15,772,106 I2611N probably benign Het
Prr12 T C 7: 45,028,530 D2019G unknown Het
Rab27a A G 9: 73,095,403 T205A probably benign Het
Rcan3 A G 4: 135,425,284 L42P probably damaging Het
Rchy1 T C 5: 91,955,615 probably null Het
Sema6a T C 18: 47,248,999 H827R probably damaging Het
Sertad4 A G 1: 192,850,950 probably null Het
Smarcd1 T A 15: 99,707,383 C282S probably damaging Het
Speg A G 1: 75,401,222 T769A possibly damaging Het
Syne1 T A 10: 5,347,875 K1141* probably null Het
Synpo2 T C 3: 123,117,666 E110G probably benign Het
Tg T A 15: 66,850,502 D333E probably benign Het
Tmem132c A G 5: 127,359,891 Y148C probably damaging Het
Tmem215 T A 4: 40,473,965 V14E probably damaging Het
Tmem229b A G 12: 78,964,911 L82P probably damaging Het
Togaram1 A G 12: 64,966,265 T97A probably benign Het
Trappc9 G A 15: 72,693,548 R965* probably null Het
Trio T C 15: 27,832,985 I104V probably benign Het
Trp73 A G 4: 154,063,895 F354S probably benign Het
Ttyh2 T C 11: 114,686,452 L63P probably damaging Het
Ulk4 G C 9: 121,044,775 P1197A probably damaging Het
Vmn1r176 T C 7: 23,835,111 M206V possibly damaging Het
Vps8 T A 16: 21,466,476 Y402* probably null Het
Zbtb41 A G 1: 139,423,193 I15V probably benign Het
Zc3hav1 T C 6: 38,307,235 I982V possibly damaging Het
Zmynd19 T A 2: 24,958,111 N106K probably benign Het
Other mutations in Hk1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00493:Hk1 APN 10 62286348 nonsense probably null
IGL01108:Hk1 APN 10 62296708 missense probably benign 0.00
IGL01810:Hk1 APN 10 62353105 missense probably benign 0.13
IGL01950:Hk1 APN 10 62315394 missense probably damaging 0.99
IGL02165:Hk1 APN 10 62281888 missense probably damaging 1.00
IGL02227:Hk1 APN 10 62281140 splice site probably benign
IGL02257:Hk1 APN 10 62271643 missense probably benign 0.07
IGL02341:Hk1 APN 10 62284380 missense possibly damaging 0.54
IGL02553:Hk1 APN 10 62295773 missense possibly damaging 0.71
IGL02623:Hk1 APN 10 62292359 missense probably benign 0.21
IGL02700:Hk1 APN 10 62284811 missense probably damaging 1.00
IGL02863:Hk1 APN 10 62295755 missense possibly damaging 0.83
IGL03002:Hk1 APN 10 62271799 missense probably damaging 1.00
R0029:Hk1 UTSW 10 62315394 missense probably damaging 0.99
R0436:Hk1 UTSW 10 62299275 splice site probably benign
R0853:Hk1 UTSW 10 62271716 nonsense probably null
R1422:Hk1 UTSW 10 62296094 missense probably null 0.98
R1760:Hk1 UTSW 10 62281899 missense probably damaging 1.00
R2064:Hk1 UTSW 10 62286536 missense probably benign 0.03
R3236:Hk1 UTSW 10 62296019 unclassified probably null
R3788:Hk1 UTSW 10 62275688 missense possibly damaging 0.85
R3977:Hk1 UTSW 10 62290319 missense probably benign 0.10
R4373:Hk1 UTSW 10 62315540 missense probably damaging 0.98
R4374:Hk1 UTSW 10 62315540 missense probably damaging 0.98
R4377:Hk1 UTSW 10 62315540 missense probably damaging 0.98
R4435:Hk1 UTSW 10 62275844 missense probably damaging 1.00
R4609:Hk1 UTSW 10 62358415 utr 5 prime probably benign
R4648:Hk1 UTSW 10 62304779 missense probably benign 0.00
R4864:Hk1 UTSW 10 62342539 missense probably benign 0.00
R4934:Hk1 UTSW 10 62358386 utr 5 prime probably benign
R5110:Hk1 UTSW 10 62286651 missense probably damaging 1.00
R5352:Hk1 UTSW 10 62304770 missense probably damaging 0.97
R5569:Hk1 UTSW 10 62286441 missense probably benign 0.35
R5609:Hk1 UTSW 10 62342551 missense probably benign 0.30
R5647:Hk1 UTSW 10 62275744 missense probably damaging 0.99
R5750:Hk1 UTSW 10 62274466 missense possibly damaging 0.86
R5770:Hk1 UTSW 10 62286449 missense probably benign
R5832:Hk1 UTSW 10 62292365 missense probably benign 0.17
R5905:Hk1 UTSW 10 62353058 missense probably null 0.82
R5933:Hk1 UTSW 10 62269994 missense probably damaging 1.00
R6028:Hk1 UTSW 10 62353058 missense probably null 0.82
R6196:Hk1 UTSW 10 62299259 missense probably damaging 1.00
R6314:Hk1 UTSW 10 62292444 missense possibly damaging 0.93
R6372:Hk1 UTSW 10 62291978 missense probably benign
R6801:Hk1 UTSW 10 62281131 missense probably damaging 0.97
R6838:Hk1 UTSW 10 62271658 missense probably damaging 0.98
R7045:Hk1 UTSW 10 62286570 missense probably damaging 1.00
R7420:Hk1 UTSW 10 62269982 missense probably damaging 1.00
R7491:Hk1 UTSW 10 62295745 missense probably damaging 1.00
R7527:Hk1 UTSW 10 62304782 missense probably damaging 0.99
R7561:Hk1 UTSW 10 62281028 splice site probably null
X0018:Hk1 UTSW 10 62275706 missense probably benign 0.02
X0063:Hk1 UTSW 10 62275704 nonsense probably null
Predicted Primers PCR Primer
(F):5'- CTGATGCTTTAGGGGCACAGCTAC -3'
(R):5'- AGCTTGTGACTCAGAGCCTAGACC -3'

Sequencing Primer
(F):5'- ATGTGGCAGACACGGGTTATC -3'
(R):5'- ACCGTGCTGTATACCACAGG -3'
Posted On2014-04-13