Incidental Mutation 'R1531:Tmem132c'
ID 166191
Institutional Source Beutler Lab
Gene Symbol Tmem132c
Ensembl Gene ENSMUSG00000034324
Gene Name transmembrane protein 132C
Synonyms 2810482M11Rik, 4632425D07Rik
MMRRC Submission 039570-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.079) question?
Stock # R1531 (G1)
Quality Score 225
Status Not validated
Chromosome 5
Chromosomal Location 127318890-127642854 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 127436955 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Cysteine at position 148 (Y148C)
Ref Sequence ENSEMBL: ENSMUSP00000113090 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000119026]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000119026
AA Change: Y148C

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000113090
Gene: ENSMUSG00000034324
AA Change: Y148C

DomainStartEndE-ValueType
low complexity region 14 21 N/A INTRINSIC
Pfam:TMEM132D_N 58 187 1.2e-54 PFAM
Pfam:TMEM132 444 787 4.5e-143 PFAM
Pfam:TMEM132D_C 892 980 2.4e-39 PFAM
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.1%
  • 10x: 95.6%
  • 20x: 90.3%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 85 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Agtpbp1 T A 13: 59,648,448 (GRCm39) probably null Het
Aldh3b2 T G 19: 4,027,543 (GRCm39) F28C probably damaging Het
Apaf1 T C 10: 90,890,383 (GRCm39) N540S probably damaging Het
Apob T C 12: 8,047,880 (GRCm39) I953T possibly damaging Het
Arhgef1 A G 7: 24,624,423 (GRCm39) T816A probably damaging Het
Arid4a T A 12: 71,122,779 (GRCm39) F1053L probably benign Het
Atxn1l A C 8: 110,458,691 (GRCm39) F524V probably damaging Het
Cad T A 5: 31,233,563 (GRCm39) M1874K probably benign Het
Ccdc40 G A 11: 119,154,015 (GRCm39) V1096I probably benign Het
Ccdc93 A G 1: 121,408,551 (GRCm39) D358G probably benign Het
Cd96 T C 16: 45,938,169 (GRCm39) T99A probably benign Het
Cdc42ep3 A T 17: 79,642,473 (GRCm39) M149K probably benign Het
Cgas A G 9: 78,349,763 (GRCm39) Y200H probably damaging Het
Cog4 A G 8: 111,606,353 (GRCm39) E613G probably benign Het
Crebbp A T 16: 3,902,381 (GRCm39) I2286N probably benign Het
Csf1 T C 3: 107,655,654 (GRCm39) E459G possibly damaging Het
Csrp2 A T 10: 110,771,066 (GRCm39) Y57F probably benign Het
Ctdspl C T 9: 118,869,650 (GRCm39) P244L probably damaging Het
Cyp2c29 A G 19: 39,313,412 (GRCm39) R303G probably damaging Het
Cyp4a10 C A 4: 115,375,632 (GRCm39) Y38* probably null Het
Dmgdh T A 13: 93,880,919 (GRCm39) I783N probably damaging Het
Efcc1 G A 6: 87,708,148 (GRCm39) E92K probably benign Het
Eif2ak4 T A 2: 118,273,691 (GRCm39) L872H probably damaging Het
Elp2 T A 18: 24,764,461 (GRCm39) S603T probably benign Het
Eml2 T A 7: 18,930,179 (GRCm39) L300H probably damaging Het
Esp3 A G 17: 40,946,827 (GRCm39) K50R possibly damaging Het
Esrp1 A G 4: 11,379,375 (GRCm39) F136L probably damaging Het
Exoc1 T A 5: 76,707,011 (GRCm39) D497E probably damaging Het
Fat3 A G 9: 15,908,761 (GRCm39) S2414P probably damaging Het
Foxj3 C T 4: 119,477,398 (GRCm39) P369S unknown Het
Gkn2 G T 6: 87,352,921 (GRCm39) probably null Het
Gm17333 AAGAAGAGAAGAGAAGAGAAGAGAAGAGAAGAGAA AAGAAGAGAAGAGAAGAGAAGAGAAGAGAA 16: 77,649,766 (GRCm39) noncoding transcript Het
Gm21905 A T 5: 68,103,724 (GRCm39) probably benign Het
Grhl1 T A 12: 24,632,962 (GRCm39) probably null Het
Grk6 A G 13: 55,599,967 (GRCm39) Y221C probably damaging Het
Hcrtr1 T A 4: 130,024,720 (GRCm39) K389* probably null Het
Hk1 G A 10: 62,120,563 (GRCm39) R545C probably damaging Het
Hsp90b1 A T 10: 86,532,659 (GRCm39) I339N probably benign Het
Ikzf3 T C 11: 98,381,272 (GRCm39) R103G probably damaging Het
Itgad A C 7: 127,777,542 (GRCm39) I141L probably benign Het
Jmjd6 T A 11: 116,733,266 (GRCm39) Y137F probably benign Het
Kcna1 A G 6: 126,619,030 (GRCm39) V430A probably benign Het
Kel A G 6: 41,665,560 (GRCm39) V520A probably damaging Het
Klhl41 G A 2: 69,501,084 (GRCm39) V182I probably benign Het
Ldhb C A 6: 142,447,121 (GRCm39) M64I probably benign Het
Lrrc23 A G 6: 124,753,077 (GRCm39) S190P possibly damaging Het
Mboat2 T C 12: 25,009,029 (GRCm39) V445A probably benign Het
Mlycd G A 8: 120,128,258 (GRCm39) W188* probably null Het
Mpp3 C T 11: 101,899,475 (GRCm39) E349K probably benign Het
Mtres1 A G 10: 43,401,316 (GRCm39) V211A probably benign Het
Myh4 A G 11: 67,141,366 (GRCm39) M780V probably benign Het
Myh6 G A 14: 55,193,963 (GRCm39) R809C probably damaging Het
Mylip G A 13: 45,560,046 (GRCm39) V161M possibly damaging Het
Nrp1 G A 8: 129,152,450 (GRCm39) V220I probably null Het
Nup210 A T 6: 91,011,823 (GRCm39) N455K probably benign Het
Or14j10 A T 17: 37,935,243 (GRCm39) Y94* probably null Het
Or51f1d C A 7: 102,700,795 (GRCm39) Q97K probably benign Het
Pbld2 G T 10: 62,889,732 (GRCm39) probably null Het
Pclo C G 5: 14,571,917 (GRCm39) P434R probably damaging Het
Pdlim3 A G 8: 46,349,800 (GRCm39) K37E probably damaging Het
Prkdc T A 16: 15,589,970 (GRCm39) I2611N probably benign Het
Prr12 T C 7: 44,677,954 (GRCm39) D2019G unknown Het
Rab27a A G 9: 73,002,685 (GRCm39) T205A probably benign Het
Rcan3 A G 4: 135,152,595 (GRCm39) L42P probably damaging Het
Rchy1 T C 5: 92,103,474 (GRCm39) probably null Het
Sema6a T C 18: 47,382,066 (GRCm39) H827R probably damaging Het
Sertad4 A G 1: 192,533,258 (GRCm39) probably null Het
Smarcd1 T A 15: 99,605,264 (GRCm39) C282S probably damaging Het
Speg A G 1: 75,377,866 (GRCm39) T769A possibly damaging Het
Syne1 T A 10: 5,297,875 (GRCm39) K1141* probably null Het
Synpo2 T C 3: 122,911,315 (GRCm39) E110G probably benign Het
Tg T A 15: 66,722,351 (GRCm39) D333E probably benign Het
Tmem215 T A 4: 40,473,965 (GRCm39) V14E probably damaging Het
Tmem229b A G 12: 79,011,685 (GRCm39) L82P probably damaging Het
Togaram1 A G 12: 65,013,039 (GRCm39) T97A probably benign Het
Trappc9 G A 15: 72,565,397 (GRCm39) R965* probably null Het
Trio T C 15: 27,833,071 (GRCm39) I104V probably benign Het
Trp73 A G 4: 154,148,352 (GRCm39) F354S probably benign Het
Ttyh2 T C 11: 114,577,278 (GRCm39) L63P probably damaging Het
Ulk4 G C 9: 120,873,841 (GRCm39) P1197A probably damaging Het
Vmn1r176 T C 7: 23,534,536 (GRCm39) M206V possibly damaging Het
Vps8 T A 16: 21,285,226 (GRCm39) Y402* probably null Het
Zbtb41 A G 1: 139,350,931 (GRCm39) I15V probably benign Het
Zc3hav1 T C 6: 38,284,170 (GRCm39) I982V possibly damaging Het
Zmynd19 T A 2: 24,848,123 (GRCm39) N106K probably benign Het
Other mutations in Tmem132c
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00869:Tmem132c APN 5 127,640,306 (GRCm39) missense possibly damaging 0.95
IGL00985:Tmem132c APN 5 127,581,930 (GRCm39) missense probably damaging 0.99
IGL01599:Tmem132c APN 5 127,436,616 (GRCm39) splice site probably benign
IGL01750:Tmem132c APN 5 127,540,023 (GRCm39) missense possibly damaging 0.91
IGL01893:Tmem132c APN 5 127,540,093 (GRCm39) missense possibly damaging 0.51
IGL02143:Tmem132c APN 5 127,640,466 (GRCm39) missense probably benign 0.03
IGL02164:Tmem132c APN 5 127,613,441 (GRCm39) missense probably damaging 1.00
IGL02252:Tmem132c APN 5 127,539,991 (GRCm39) missense possibly damaging 0.91
IGL02527:Tmem132c APN 5 127,436,675 (GRCm39) missense possibly damaging 0.95
IGL02584:Tmem132c APN 5 127,582,063 (GRCm39) missense probably damaging 1.00
IGL02878:Tmem132c APN 5 127,640,154 (GRCm39) missense probably damaging 0.99
IGL03065:Tmem132c APN 5 127,640,688 (GRCm39) missense probably damaging 1.00
IGL03120:Tmem132c APN 5 127,640,448 (GRCm39) missense probably benign 0.06
IGL03380:Tmem132c APN 5 127,613,506 (GRCm39) missense probably benign 0.00
IGL03387:Tmem132c APN 5 127,640,784 (GRCm39) missense probably benign 0.00
R0106:Tmem132c UTSW 5 127,631,733 (GRCm39) missense possibly damaging 0.94
R0106:Tmem132c UTSW 5 127,631,733 (GRCm39) missense possibly damaging 0.94
R0415:Tmem132c UTSW 5 127,640,769 (GRCm39) missense probably damaging 1.00
R0607:Tmem132c UTSW 5 127,640,617 (GRCm39) nonsense probably null
R1413:Tmem132c UTSW 5 127,640,631 (GRCm39) missense probably damaging 1.00
R1648:Tmem132c UTSW 5 127,540,120 (GRCm39) splice site probably benign
R2148:Tmem132c UTSW 5 127,540,026 (GRCm39) missense probably damaging 1.00
R2149:Tmem132c UTSW 5 127,540,026 (GRCm39) missense probably damaging 1.00
R2259:Tmem132c UTSW 5 127,581,988 (GRCm39) missense probably benign 0.01
R3853:Tmem132c UTSW 5 127,436,933 (GRCm39) missense probably benign 0.00
R4204:Tmem132c UTSW 5 127,640,829 (GRCm39) missense possibly damaging 0.73
R4543:Tmem132c UTSW 5 127,582,041 (GRCm39) missense probably benign 0.00
R4701:Tmem132c UTSW 5 127,641,560 (GRCm39) unclassified probably benign
R5017:Tmem132c UTSW 5 127,640,414 (GRCm39) missense probably benign 0.13
R5037:Tmem132c UTSW 5 127,630,199 (GRCm39) missense probably benign 0.42
R5327:Tmem132c UTSW 5 127,640,816 (GRCm39) missense possibly damaging 0.50
R5423:Tmem132c UTSW 5 127,640,907 (GRCm39) missense probably benign 0.02
R5548:Tmem132c UTSW 5 127,628,587 (GRCm39) nonsense probably null
R6425:Tmem132c UTSW 5 127,630,329 (GRCm39) missense possibly damaging 0.95
R6717:Tmem132c UTSW 5 127,641,093 (GRCm39) missense possibly damaging 0.93
R6899:Tmem132c UTSW 5 127,628,744 (GRCm39) missense probably damaging 1.00
R7007:Tmem132c UTSW 5 127,436,679 (GRCm39) missense probably damaging 1.00
R7297:Tmem132c UTSW 5 127,437,281 (GRCm39) missense probably benign 0.06
R7326:Tmem132c UTSW 5 127,641,123 (GRCm39) missense possibly damaging 0.51
R7386:Tmem132c UTSW 5 127,640,990 (GRCm39) missense probably benign 0.16
R7504:Tmem132c UTSW 5 127,631,696 (GRCm39) missense probably damaging 1.00
R7640:Tmem132c UTSW 5 127,640,070 (GRCm39) missense probably damaging 1.00
R7718:Tmem132c UTSW 5 127,640,504 (GRCm39) missense probably benign 0.06
R7762:Tmem132c UTSW 5 127,631,760 (GRCm39) missense possibly damaging 0.90
R7818:Tmem132c UTSW 5 127,641,152 (GRCm39) makesense probably null
R8117:Tmem132c UTSW 5 127,437,176 (GRCm39) missense probably benign 0.22
R8425:Tmem132c UTSW 5 127,641,421 (GRCm39) missense
R8749:Tmem132c UTSW 5 127,437,003 (GRCm39) missense possibly damaging 0.75
R8771:Tmem132c UTSW 5 127,437,192 (GRCm39) missense probably benign 0.00
R8798:Tmem132c UTSW 5 127,437,217 (GRCm39) nonsense probably null
R9372:Tmem132c UTSW 5 127,640,145 (GRCm39) missense probably damaging 1.00
X0067:Tmem132c UTSW 5 127,613,471 (GRCm39) missense possibly damaging 0.79
Z1088:Tmem132c UTSW 5 127,581,985 (GRCm39) missense probably benign 0.14
Predicted Primers PCR Primer
(F):5'- TTTCTTCATCTACAAGGCCCAGCAG -3'
(R):5'- GCATAATACAGTTCCACCGGACTCC -3'

Sequencing Primer
(F):5'- GCCCCCGGTATTAAACGTC -3'
(R):5'- ATACAACCGCTGGGGGAC -3'
Posted On 2014-04-13