Incidental Mutation 'R6137:Sgsm2'
ID488415
Institutional Source Beutler Lab
Gene Symbol Sgsm2
Ensembl Gene ENSMUSG00000038351
Gene Namesmall G protein signaling modulator 2
SynonymsD630003G22Rik, Rutbc1
MMRRC Submission 044284-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.268) question?
Stock #R6137 (G1)
Quality Score225.009
Status Validated
Chromosome11
Chromosomal Location74849261-74897060 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 74850851 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Tryptophan at position 1037 (R1037W)
Ref Sequence ENSEMBL: ENSMUSP00000080489 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000057631] [ENSMUST00000081799]
Predicted Effect probably damaging
Transcript: ENSMUST00000057631
AA Change: R992W

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000050496
Gene: ENSMUSG00000038351
AA Change: R992W

DomainStartEndE-ValueType
RUN 128 188 4.3e-18 SMART
low complexity region 453 476 N/A INTRINSIC
TBC 563 965 3.57e-34 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000081799
AA Change: R1037W

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000080489
Gene: ENSMUSG00000038351
AA Change: R1037W

DomainStartEndE-ValueType
RUN 128 188 4.3e-18 SMART
low complexity region 446 453 N/A INTRINSIC
low complexity region 498 521 N/A INTRINSIC
TBC 608 1010 3.57e-34 SMART
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.8%
  • 20x: 93.3%
Validation Efficiency 98% (58/59)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a GTPase activator with activity towards RAB32 and RAB33B, which are regulators of membrane trafficking. The encoded protein inactivates RAB32 and can bind RAB9A-GTP, a protein required for RAB32 activation. [provided by RefSeq, Oct 2016]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700092M07Rik A T 19: 8,740,784 D6V probably damaging Het
2310057M21Rik G T 7: 131,357,613 H165Q probably damaging Het
Akap13 T A 7: 75,677,416 F721Y probably damaging Het
Akap6 A T 12: 53,140,354 D1517V probably damaging Het
Amigo3 T A 9: 108,053,728 S117T probably damaging Het
Atf7ip2 T A 16: 10,201,411 N34K probably damaging Het
Cacnb1 A C 11: 98,005,782 V351G probably damaging Het
Casp9 T A 4: 141,805,349 probably null Het
Ccdc51 C T 9: 109,089,415 T24I probably benign Het
Cdh23 T A 10: 60,434,512 Y618F probably damaging Het
Chd1 T A 17: 15,758,688 W1271R probably damaging Het
Dars T C 1: 128,368,439 T386A probably benign Het
Dchs1 T A 7: 105,765,106 D834V probably damaging Het
Dgkd T A 1: 87,936,381 V933E possibly damaging Het
Dnah17 A G 11: 118,025,654 F4203S probably damaging Het
Fancm T C 12: 65,130,382 L2000P probably damaging Het
Fbxo11 A T 17: 88,008,669 H444Q probably benign Het
Fbxw14 T A 9: 109,276,222 T292S probably damaging Het
Fer1l6 T C 15: 58,559,206 S237P probably damaging Het
Frem3 T C 8: 80,615,047 I1323T probably benign Het
Grin2a A G 16: 9,653,449 F652L probably benign Het
Grin2b T A 6: 135,923,458 M142L possibly damaging Het
Helz A G 11: 107,619,060 Q503R possibly damaging Het
Ighv5-17 A G 12: 113,859,295 Y69H probably benign Het
Il17ra A G 6: 120,475,582 N242S probably benign Het
Immp1l G C 2: 105,964,208 G117A probably damaging Het
Itm2c T C 1: 85,894,692 V10A probably benign Het
Kif1b T C 4: 149,238,426 K679E possibly damaging Het
Kng1 T C 16: 23,074,645 V256A possibly damaging Het
Lamc2 T G 1: 153,166,153 R78S possibly damaging Het
Loxl4 A G 19: 42,598,793 F621S probably damaging Het
Lpl T A 8: 68,892,747 D134E probably damaging Het
Lypd3 T C 7: 24,640,494 Y329H probably benign Het
Mettl13 T C 1: 162,535,886 D225G probably benign Het
Myo7b A G 18: 31,999,974 F441L probably damaging Het
Nnt T A 13: 119,336,328 M699L possibly damaging Het
Nr1h3 A T 2: 91,191,851 M144K probably damaging Het
Olfr1040 A G 2: 86,145,969 V255A probably benign Het
Olfr1347 T C 7: 6,488,845 T3A probably benign Het
Olfr325 A T 11: 58,581,068 M75L probably benign Het
Pappa2 A T 1: 158,871,543 Y667N probably damaging Het
Prps1l3 A G 12: 57,238,888 I155V probably benign Het
Ptgs2 T A 1: 150,100,993 N24K probably benign Het
Ralgds A T 2: 28,547,588 M514L probably damaging Het
Rbm47 G C 5: 66,026,283 R326G probably damaging Het
Sacm1l T A 9: 123,569,005 V254D probably damaging Het
Selenot A T 3: 58,585,284 Q64L probably damaging Het
Slc22a12 A G 19: 6,542,724 V10A probably benign Het
Spem2 G T 11: 69,816,696 S481* probably null Het
Styk1 C T 6: 131,311,016 G128D probably damaging Het
Tmc6 A T 11: 117,776,328 L148Q probably damaging Het
Tmem138 A C 19: 10,574,835 probably null Het
Tnpo3 A G 6: 29,555,268 V772A probably benign Het
Topaz1 T C 9: 122,797,756 F1483S possibly damaging Het
Tuba4a C A 1: 75,216,055 C305F probably damaging Het
Ubap1 T G 4: 41,379,262 F159V possibly damaging Het
Vmn2r9 A G 5: 108,849,016 I129T probably benign Het
Wwc2 A T 8: 47,856,263 M828K unknown Het
Zfp236 A T 18: 82,671,794 S187T possibly damaging Het
Other mutations in Sgsm2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01469:Sgsm2 APN 11 74853871 missense possibly damaging 0.91
IGL02164:Sgsm2 APN 11 74865416 missense possibly damaging 0.90
IGL02236:Sgsm2 APN 11 74859872 missense probably damaging 1.00
IGL02330:Sgsm2 APN 11 74858667 missense probably benign 0.01
IGL02352:Sgsm2 APN 11 74892074 splice site probably benign
IGL02359:Sgsm2 APN 11 74892074 splice site probably benign
IGL03061:Sgsm2 APN 11 74851136 missense probably damaging 1.00
IGL03180:Sgsm2 APN 11 74868575 critical splice donor site probably null
R0208:Sgsm2 UTSW 11 74868241 missense probably damaging 1.00
R0433:Sgsm2 UTSW 11 74858190 splice site probably null
R0517:Sgsm2 UTSW 11 74867651 missense possibly damaging 0.62
R0755:Sgsm2 UTSW 11 74865497 missense probably damaging 1.00
R1439:Sgsm2 UTSW 11 74869138 missense probably benign 0.34
R1527:Sgsm2 UTSW 11 74853848 nonsense probably null
R1713:Sgsm2 UTSW 11 74896826 missense probably null 0.04
R1962:Sgsm2 UTSW 11 74892028 missense probably damaging 1.00
R2189:Sgsm2 UTSW 11 74853082 missense probably damaging 1.00
R4259:Sgsm2 UTSW 11 74892028 missense probably damaging 1.00
R4261:Sgsm2 UTSW 11 74892028 missense probably damaging 1.00
R4408:Sgsm2 UTSW 11 74851766 missense probably damaging 0.99
R4590:Sgsm2 UTSW 11 74851132 missense probably damaging 1.00
R6162:Sgsm2 UTSW 11 74892021 missense probably damaging 1.00
R6457:Sgsm2 UTSW 11 74865169 missense possibly damaging 0.77
R6681:Sgsm2 UTSW 11 74865378 missense probably damaging 0.99
R6722:Sgsm2 UTSW 11 74865424 missense probably damaging 1.00
R6986:Sgsm2 UTSW 11 74892041 missense probably damaging 1.00
R7205:Sgsm2 UTSW 11 74854493 missense possibly damaging 0.88
R7209:Sgsm2 UTSW 11 74854325 missense probably damaging 0.98
R7655:Sgsm2 UTSW 11 74865497 missense probably damaging 1.00
R7656:Sgsm2 UTSW 11 74865497 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CACTTTGTTAGGTTACACAGCTGAG -3'
(R):5'- CATTCTCGATGTGCCCTAGAAG -3'

Sequencing Primer
(F):5'- TACACAGCTGAGTGGGTGG -3'
(R):5'- TCAAGTCCTGGACTGGGCAG -3'
Posted On2017-10-10