Incidental Mutation 'R1554:Stk38'
ID170191
Institutional Source Beutler Lab
Gene Symbol Stk38
Ensembl Gene ENSMUSG00000024006
Gene Nameserine/threonine kinase 38
Synonyms9530097A09Rik, Ndr1, 5830476G13Rik
MMRRC Submission 039593-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.453) question?
Stock #R1554 (G1)
Quality Score225
Status Not validated
Chromosome17
Chromosomal Location28970885-29007945 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 28979232 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Isoleucine at position 248 (N248I)
Ref Sequence ENSEMBL: ENSMUSP00000113657 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000009138] [ENSMUST00000119274]
Predicted Effect possibly damaging
Transcript: ENSMUST00000009138
AA Change: N248I

PolyPhen 2 Score 0.870 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000009138
Gene: ENSMUSG00000024006
AA Change: N248I

DomainStartEndE-ValueType
Blast:S_TKc 31 77 1e-9 BLAST
S_TKc 89 382 1.69e-94 SMART
S_TK_X 383 447 1.23e-2 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000119274
AA Change: N248I

PolyPhen 2 Score 0.870 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000113657
Gene: ENSMUSG00000024006
AA Change: N248I

DomainStartEndE-ValueType
Blast:S_TKc 31 77 1e-9 BLAST
S_TKc 89 382 1.69e-94 SMART
S_TK_X 383 447 1.23e-2 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125070
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126619
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126671
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126893
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140355
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141431
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142923
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144299
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144516
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.0%
  • 10x: 95.2%
  • 20x: 89.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the AGC serine/threonine kinase family of proteins. The kinase activity of this protein is regulated by autophosphorylation and phosphorylation by other upstream kinases. This protein has been shown to function in the cell cycle and apoptosis. This protein has also been found to regulate the protein stability and transcriptional activity of the MYC oncogene. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Feb 2015]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit increased susceptibility to bacterial infection and altered TLR9-activated inflammatory responses. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A1cf T A 19: 31,908,902 D70E possibly damaging Het
Adamts7 A T 9: 90,173,650 D152V probably damaging Het
Api5 T C 2: 94,425,643 D233G probably benign Het
Btaf1 A G 19: 36,996,598 D1390G probably benign Het
Cep135 G A 5: 76,634,213 W893* probably null Het
Cmtm6 T A 9: 114,746,482 V153D possibly damaging Het
Dnah11 C T 12: 118,082,499 V1735I possibly damaging Het
Dnm1l T C 16: 16,341,426 N104S probably benign Het
Dpyd A T 3: 119,065,046 probably null Het
Dtx1 T C 5: 120,683,321 K387R probably damaging Het
Ercc4 A G 16: 13,147,622 D706G probably damaging Het
Fam208b A G 13: 3,576,374 V1192A possibly damaging Het
Fat2 T C 11: 55,253,664 N4128S probably benign Het
Gm42669 T A 5: 107,507,787 C639S possibly damaging Het
Grk3 T A 5: 112,969,269 I89L possibly damaging Het
Grm8 A T 6: 28,125,853 D91E probably benign Het
Havcr1 C A 11: 46,752,507 H85N probably benign Het
Il12rb1 G A 8: 70,813,372 probably null Het
Kif3a A G 11: 53,598,327 K117E probably damaging Het
Kitl T A 10: 100,087,438 F15L probably benign Het
Ktn1 T G 14: 47,695,507 L706R probably damaging Het
Lipg T C 18: 74,948,047 Y321C probably damaging Het
Mapk8ip3 T C 17: 24,903,059 D710G probably benign Het
Mb21d1 A T 9: 78,435,556 S321R probably damaging Het
Mchr1 A G 15: 81,235,820 N16S probably benign Het
Myadml2 A T 11: 120,647,727 L94* probably null Het
Npr3 C A 15: 11,848,563 M439I probably benign Het
Obscn A G 11: 59,003,648 I6677T unknown Het
Ogn A C 13: 49,621,044 D221A probably benign Het
Olfr889 T C 9: 38,115,934 I46T probably benign Het
Pard3b C A 1: 62,637,894 Q1195K probably damaging Het
Pcsk4 T C 10: 80,321,951 E608G probably benign Het
Pdlim1 T C 19: 40,223,072 D259G probably benign Het
Per1 T C 11: 69,103,627 S526P probably damaging Het
Pfkfb2 A G 1: 130,706,472 V156A probably damaging Het
Ppp4r3a A T 12: 101,055,822 D307E probably damaging Het
Rims4 T C 2: 163,879,122 S70G probably damaging Het
Rnf213 T C 11: 119,441,839 F2625L probably benign Het
Sap130 T C 18: 31,666,472 L334P probably damaging Het
Slc16a10 T C 10: 40,076,800 I233V probably benign Het
Slc16a7 A C 10: 125,230,922 F283V possibly damaging Het
Slc25a24 T C 3: 109,136,270 M81T probably benign Het
Slc30a9 A G 5: 67,326,921 R134G probably damaging Het
Slc35d3 G T 10: 19,850,737 L96M probably damaging Het
Slc7a11 C T 3: 50,381,896 G333D probably damaging Het
Stam T C 2: 14,141,828 S446P probably benign Het
Tle6 A C 10: 81,595,385 S221A probably benign Het
Tmprss11b G A 5: 86,661,631 T334I probably benign Het
Tmprss11c T A 5: 86,289,260 M1L possibly damaging Het
Tpm1 T C 9: 67,023,429 H262R probably benign Het
Tspan33 T C 6: 29,711,082 S118P possibly damaging Het
Tyk2 A G 9: 21,107,922 V1068A probably damaging Het
Ubr2 T C 17: 46,972,951 I591V probably benign Het
Utp20 A T 10: 88,764,737 Y38* probably null Het
Vmn1r217 A T 13: 23,114,294 I146N possibly damaging Het
Zfp608 T C 18: 54,898,054 Y938C probably damaging Het
Other mutations in Stk38
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02364:Stk38 APN 17 28991416 missense probably benign
IGL03279:Stk38 APN 17 28984205 splice site probably benign
R0029:Stk38 UTSW 17 28982138 missense probably benign 0.00
R0276:Stk38 UTSW 17 28992416 critical splice donor site probably null
R0611:Stk38 UTSW 17 28975933 missense possibly damaging 0.72
R4583:Stk38 UTSW 17 28982156 missense probably damaging 1.00
R5191:Stk38 UTSW 17 28974370 missense probably benign 0.19
R5686:Stk38 UTSW 17 28982129 missense probably damaging 1.00
R6366:Stk38 UTSW 17 28974364 missense probably benign 0.01
R6468:Stk38 UTSW 17 28984112 missense probably benign 0.35
R6830:Stk38 UTSW 17 29000007 critical splice donor site probably null
R7237:Stk38 UTSW 17 28974646 missense possibly damaging 0.49
R8000:Stk38 UTSW 17 28992448 missense probably benign
R8263:Stk38 UTSW 17 28984187 missense probably damaging 1.00
R8551:Stk38 UTSW 17 28988225 missense probably damaging 1.00
R8805:Stk38 UTSW 17 29000120 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- CTGCATTAGCACAGTTGGAAGCG -3'
(R):5'- TCCTTGTAGTAAGCTGGGTAGGAGAAG -3'

Sequencing Primer
(F):5'- TCATCTCGCCTAGTCAGACAG -3'
(R):5'- gctgggtaggagaagtctgtTG -3'
Posted On2014-04-13