Mutagenetix > Incidental Mutations

Incidental Mutation 'R1575:Vwf'

171091

Institutional Source

Beutler Lab

Gene Symbol

Vwf

Ensembl Gene

ENSMUSG00000001930

Gene Name

Von Willebrand factor

Synonyms

6820430P06Rik, B130011O06Rik

MMRRC Submission

039613-MU

Accession Numbers

Genbank: NM_011708; MGI: 98941

Is this an essential gene?

Probably non essential (E-score: 0.193) question?

Stock #

R1575 (G1)

Quality Score

186

Status

Validated

Chromosome

Chromosomal Location

125546774-125686679 bp(+) (GRCm38)

Type of Mutation

nonsense

DNA Base Change (assembly)

T to A at 125663571 bp

Zygosity

Heterozygous

Amino Acid Change

Tyrosine to Stop codon at position 2323 (Y2323*)

Ref Sequence

ENSEMBL: ENSMUSP00000107873 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000112254]

Predicted Effect

probably null
Transcript: ENSMUST00000112254
AA Change: Y2323*

SMART Domains

Protein: ENSMUSP00000107873
Gene: ENSMUSG00000001930
AA Change: Y2323*

Domain	Start	End	E-Value	Type
VWD	23	181	3.43e-35	SMART
C8	221	295	1.11e-21	SMART
Pfam:TIL	298	351	6.9e-15	PFAM
VWC	353	413	8.71e-1	SMART
VWD	380	543	2.93e-52	SMART
C8	580	652	3.82e-25	SMART
Pfam:TIL	655	710	4.1e-14	PFAM
EGF_like	790	825	4.37e1	SMART
VWC	832	901	3.29e-3	SMART
VWD	859	1015	5.15e-39	SMART
C8	1056	1130	1.01e-33	SMART
Pfam:TIL	1144	1199	1.3e-9	PFAM
VWA	1278	1461	1.81e-20	SMART
low complexity region	1464	1477	N/A	INTRINSIC
VWA	1499	1672	8.43e-39	SMART
VWA	1692	1875	2.83e-31	SMART
VWC	1882	1949	2.99e0	SMART
VWD	1941	2104	5.03e-42	SMART
C8	2135	2203	1.29e-13	SMART
Pfam:TIL	2206	2257	8.3e-8	PFAM
VWC	2260	2328	3.16e-16	SMART
low complexity region	2417	2428	N/A	INTRINSIC
VWC	2434	2497	2.61e-17	SMART
VWC	2513	2577	3.37e0	SMART
VWC	2585	2647	2.55e-11	SMART
CT	2730	2815	1.37e-31	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000141521

Predicted Effect

unknown
Transcript: ENSMUST00000147101
AA Change: M360K

Meta Mutation Damage Score

0.9754

Coding Region Coverage

1x: 99.1%
3x: 98.2%
10x: 96.0%
20x: 91.5%

Validation Efficiency

100% (72/72)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a glycoprotein involved in hemostasis. The encoded preproprotein is proteolytically processed following assembly into large multimeric complexes. These complexes function in the adhesion of platelets to sites of vascular injury and the transport of various proteins in the blood. Mutations in this gene result in von Willebrand disease, an inherited bleeding disorder. An unprocessed pseudogene has been found on chromosome 22. [provided by RefSeq, Oct 2015]
PHENOTYPE: Homozygous null mutants exhibit hemostatic and thrombotic defects similar to human von Willebrand disease. Mutants have prolonged bleeding time, newborns occasionally show fatal intra-abdominal bleeding and some adults have detectable fecal occult blood. [provided by MGI curators]

Allele List at MGI

All alleles(33) : Targeted, knock-out(1) Gene trapped(32)

Other mutations in this stock

Total: 66 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adgrl2	T	A	3: 148,852,762	T437S	probably benign	Het
Akna	A	G	4: 63,379,333	F828S	probably benign	Het
Alg9	G	T	9: 50,775,502	A40S	possibly damaging	Het
Alox8	T	A	11: 69,185,241	H628L	possibly damaging	Het
Aox3	T	C	1: 58,152,554	W422R	probably benign	Het
Atp13a4	T	C	16: 29,409,710	D984G	probably benign	Het
Bcam	T	C	7: 19,760,382	E363G	possibly damaging	Het
Cadps2	C	A	6: 23,429,218	V519F	probably damaging	Het
Calca	A	G	7: 114,635,161	Y18H	probably damaging	Het
Cd70	A	G	17: 57,146,364	I100T	probably damaging	Het
Cdk4	T	A	10: 127,064,651	H95Q	probably damaging	Het
Chchd1	T	A	14: 20,703,342	N11K	probably damaging	Het
Cma2	T	A	14: 55,972,815	N52K	probably damaging	Het
Cyp3a16	A	G	5: 145,436,457	V500A	probably benign	Het
Dicer1	A	G	12: 104,721,969		probably null	Het
Dnajc13	A	G	9: 104,156,838	S2206P	probably benign	Het
Dtl	T	C	1: 191,561,546		probably null	Het
Fam186b	T	C	15: 99,286,971	T24A	probably benign	Het
Fbxw21	A	G	9: 109,161,916	V25A	probably benign	Het
Gins1	T	C	2: 150,912,838	S45P	probably benign	Het
Gtpbp2	T	A	17: 46,165,943	V349D	probably damaging	Het
Hyal5	G	T	6: 24,876,793	D222Y	probably damaging	Het
Itgal	A	G	7: 127,300,888		probably null	Het
Klk14	A	G	7: 43,693,953		probably null	Het
Lama1	T	A	17: 67,810,409	L2518Q	possibly damaging	Het
Lrrc2	G	A	9: 110,979,487	G264D	probably benign	Het
Ltbp4	A	G	7: 27,322,820	S893P	probably damaging	Het
Mast4	G	A	13: 102,739,263	P1107L	probably damaging	Het
Mbd1	T	A	18: 74,275,419		probably null	Het
Naip2	A	T	13: 100,155,021	D1136E	probably benign	Het
Naip2	G	A	13: 100,155,029		probably benign	Het
Ncan	G	A	8: 70,110,198	T470I	probably benign	Het
Npy1r	A	T	8: 66,704,161	I78F	probably damaging	Het
Olfr1491	A	T	19: 13,705,525	M233L	probably benign	Het
Olfr917	G	A	9: 38,665,277	T189M	probably damaging	Het
Palb2	A	T	7: 122,110,838		probably null	Het
Pax3	T	C	1: 78,103,484	T422A	probably benign	Het
Pebp1	A	T	5: 117,286,164	D72E	possibly damaging	Het
Pnliprp1	A	T	19: 58,740,469	T363S	probably benign	Het
Rbm44	G	A	1: 91,156,843		probably null	Het
Rbm47	T	A	5: 66,025,015	Y425F	probably benign	Het
Robo3	G	T	9: 37,429,661	A83E	probably damaging	Het
Rrm1	A	G	7: 102,456,514	Y279C	probably damaging	Het
Rslcan18	A	T	13: 67,108,057		probably benign	Het
Scara5	C	A	14: 65,730,865	Q196K	probably benign	Het
Setd1b	C	T	5: 123,163,147		probably benign	Het
Siah1a	A	G	8: 86,725,241	F205S	probably damaging	Het
Smr2	AT	ATT	5: 88,108,824		probably null	Het
Ssu72	A	G	4: 155,731,357	D86G	probably benign	Het
St7	G	T	6: 17,886,111	K357N	probably damaging	Het
Sv2b	G	A	7: 75,147,677	T323I	probably damaging	Het
Syt1	T	C	10: 108,504,500	N319S	probably benign	Het
Tanc1	T	A	2: 59,791,651	F371L	probably damaging	Het
Tcf20	C	A	15: 82,855,492	G586V	probably benign	Het
Tg	T	C	15: 66,729,685		probably null	Het
Tyk2	A	T	9: 21,115,462	N620K	probably benign	Het
Ube2j1	T	A	4: 33,045,116	S130T	probably benign	Het
Ubr2	G	T	17: 46,932,492	P1696H	probably damaging	Het
Ubr5	A	T	15: 38,040,841	D266E	probably damaging	Het
Vipr2	A	G	12: 116,144,272	T426A	probably benign	Het
Vmn2r104	A	T	17: 20,042,215	W218R	probably damaging	Het
Vmn2r83	T	A	10: 79,479,122	N401K	probably damaging	Het
Wdr76	T	G	2: 121,528,921	V329G	probably damaging	Het
Zan	A	G	5: 137,461,952	C1226R	unknown	Het
Zbtb16	G	T	9: 48,832,272	Q247K	probably damaging	Het
Zfp541	T	C	7: 16,078,715	V431A	possibly damaging	Het

Other mutations in Vwf

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00489:Vwf	APN	6	125658872	missense	unknown
IGL00561:Vwf	APN	6	125642721	missense	possibly damaging	0.88
IGL01104:Vwf	APN	6	125683556	missense	probably damaging	1.00
IGL01404:Vwf	APN	6	125677970	missense	probably damaging	1.00
IGL01539:Vwf	APN	6	125590262	missense	possibly damaging	0.85
IGL01550:Vwf	APN	6	125679289	missense	probably benign	0.00
IGL01563:Vwf	APN	6	125591165	missense	probably damaging	1.00
IGL01637:Vwf	APN	6	125645736	missense	probably damaging	1.00
IGL01720:Vwf	APN	6	125642835	missense	possibly damaging	0.69
IGL01834:Vwf	APN	6	125590170	splice site	probably benign
IGL02103:Vwf	APN	6	125646355	missense	probably damaging	1.00
IGL02120:Vwf	APN	6	125616034	missense	probably benign	0.26
IGL02174:Vwf	APN	6	125555395	missense	probably damaging	1.00
IGL02203:Vwf	APN	6	125642406	missense	probably damaging	1.00
IGL02420:Vwf	APN	6	125677916	missense	probably benign	0.00
IGL02723:Vwf	APN	6	125642930	missense	possibly damaging	0.85
IGL02818:Vwf	APN	6	125663548	missense	probably benign
IGL02931:Vwf	APN	6	125615968	missense	possibly damaging	0.68
IGL03015:Vwf	APN	6	125684138	splice site	probably benign
IGL03038:Vwf	APN	6	125604157	missense	possibly damaging	0.92
IGL03060:Vwf	APN	6	125663560	missense	probably damaging	1.00
IGL03114:Vwf	APN	6	125599363	nonsense	probably null
IGL03266:Vwf	APN	6	125678077	splice site	probably benign
Russiahouse	UTSW	6	125639341	nonsense	probably null
B5639:Vwf	UTSW	6	125642984	missense	probably damaging	1.00
R0025:Vwf	UTSW	6	125682812	missense	probably benign	0.05
R0025:Vwf	UTSW	6	125682812	missense	probably benign	0.05
R0087:Vwf	UTSW	6	125645954	missense	probably benign	0.03
R0194:Vwf	UTSW	6	125643297	missense	probably benign
R0206:Vwf	UTSW	6	125637456	missense	probably damaging	1.00
R0233:Vwf	UTSW	6	125686510	missense	possibly damaging	0.91
R0233:Vwf	UTSW	6	125686510	missense	possibly damaging	0.91
R0390:Vwf	UTSW	6	125626361	nonsense	probably null
R0427:Vwf	UTSW	6	125673939	missense	probably benign
R0437:Vwf	UTSW	6	125566318	missense	probably damaging	1.00
R0470:Vwf	UTSW	6	125628428	missense	possibly damaging	0.70
R0499:Vwf	UTSW	6	125638114	missense	probably benign	0.10
R0554:Vwf	UTSW	6	125642781	missense	probably benign	0.13
R0605:Vwf	UTSW	6	125685837	missense	probably benign	0.02
R0711:Vwf	UTSW	6	125626271	missense	probably benign	0.01
R0723:Vwf	UTSW	6	125566262	missense	probably benign	0.01
R0973:Vwf	UTSW	6	125643006	missense	probably damaging	1.00
R1054:Vwf	UTSW	6	125590227	missense	probably damaging	1.00
R1115:Vwf	UTSW	6	125655065	missense	unknown
R1156:Vwf	UTSW	6	125637488	missense	probably damaging	1.00
R1191:Vwf	UTSW	6	125599252	missense	probably damaging	1.00
R1240:Vwf	UTSW	6	125603308	splice site	probably null
R1398:Vwf	UTSW	6	125603457	missense	probably benign	0.02
R1435:Vwf	UTSW	6	125642249	nonsense	probably null
R1528:Vwf	UTSW	6	125608291	missense	possibly damaging	0.69
R1575:Vwf	UTSW	6	125655251	missense	unknown
R1628:Vwf	UTSW	6	125647738	unclassified	probably benign
R1669:Vwf	UTSW	6	125647906	missense	possibly damaging	0.92
R1699:Vwf	UTSW	6	125643069	missense	probably damaging	1.00
R1699:Vwf	UTSW	6	125685900	missense	possibly damaging	0.74
R1725:Vwf	UTSW	6	125646282	missense	probably benign	0.05
R1742:Vwf	UTSW	6	125667550	missense	probably benign	0.02
R1809:Vwf	UTSW	6	125590175	splice site	probably benign
R1833:Vwf	UTSW	6	125642037	missense	probably benign	0.14
R1866:Vwf	UTSW	6	125667529	missense	possibly damaging	0.62
R1870:Vwf	UTSW	6	125642939	missense	probably damaging	1.00
R1874:Vwf	UTSW	6	125628372	missense	probably benign	0.00
R1941:Vwf	UTSW	6	125639279	missense	possibly damaging	0.64
R2061:Vwf	UTSW	6	125591188	missense	probably damaging	0.98
R2103:Vwf	UTSW	6	125646330	missense	probably benign	0.31
R2104:Vwf	UTSW	6	125646330	missense	probably benign	0.31
R2130:Vwf	UTSW	6	125657057	missense	probably damaging	1.00
R2159:Vwf	UTSW	6	125626341	missense	probably damaging	0.99
R2178:Vwf	UTSW	6	125642132	missense	possibly damaging	0.90
R2656:Vwf	UTSW	6	125555361	missense	probably benign	0.00
R2913:Vwf	UTSW	6	125685846	missense	probably benign	0.08
R2917:Vwf	UTSW	6	125608143	missense	probably benign	0.07
R3726:Vwf	UTSW	6	125677948	utr 3 prime	probably benign
R3735:Vwf	UTSW	6	125588613	missense	probably damaging	1.00
R3774:Vwf	UTSW	6	125649099	splice site	probably null
R3934:Vwf	UTSW	6	125555499	missense	probably damaging	1.00
R4291:Vwf	UTSW	6	125642322	missense	probably damaging	1.00
R4384:Vwf	UTSW	6	125655116	missense	unknown
R4743:Vwf	UTSW	6	125684091	critical splice acceptor site	probably null
R4760:Vwf	UTSW	6	125570604	missense	probably damaging	1.00
R4776:Vwf	UTSW	6	125566305	missense	possibly damaging	0.53
R4791:Vwf	UTSW	6	125643363	missense
R4871:Vwf	UTSW	6	125686462	missense	probably benign	0.25
R4894:Vwf	UTSW	6	125645934	nonsense	probably null
R4963:Vwf	UTSW	6	125667483	nonsense	probably null
R5010:Vwf	UTSW	6	125566257	missense	probably benign	0.15
R5289:Vwf	UTSW	6	125667510	utr 3 prime	probably benign
R5512:Vwf	UTSW	6	125673887	utr 3 prime	probably benign
R5523:Vwf	UTSW	6	125643042	missense
R5642:Vwf	UTSW	6	125603418	missense
R5860:Vwf	UTSW	6	125643090	missense
R5860:Vwf	UTSW	6	125679265	utr 3 prime	probably benign
R5896:Vwf	UTSW	6	125678762	critical splice acceptor site	probably null
R5926:Vwf	UTSW	6	125604174	missense	probably damaging	1.00
R5976:Vwf	UTSW	6	125603463	missense
R6053:Vwf	UTSW	6	125600665	missense	probably benign	0.21
R6151:Vwf	UTSW	6	125657065	missense	unknown
R6179:Vwf	UTSW	6	125649289	missense	unknown
R6181:Vwf	UTSW	6	125566146	missense	probably damaging	0.98
R6234:Vwf	UTSW	6	125657165	missense	unknown
R6360:Vwf	UTSW	6	125683526	missense	probably benign	0.13
R6412:Vwf	UTSW	6	125679316	missense	probably benign	0.00
R6464:Vwf	UTSW	6	125639400	critical splice donor site	probably null
R6522:Vwf	UTSW	6	125662963	critical splice acceptor site	probably null
R6766:Vwf	UTSW	6	125639376	missense	unknown
R6856:Vwf	UTSW	6	125642150	nonsense	probably null
R6877:Vwf	UTSW	6	125657201	missense	possibly damaging	0.48
R6896:Vwf	UTSW	6	125566194	missense	probably damaging	1.00
R7113:Vwf	UTSW	6	125655044	missense
R7287:Vwf	UTSW	6	125637467	missense
R7359:Vwf	UTSW	6	125566257	missense
R7509:Vwf	UTSW	6	125642169	missense
R7519:Vwf	UTSW	6	125667543	missense
R7545:Vwf	UTSW	6	125614097	missense
R7549:Vwf	UTSW	6	125626267	missense
R7593:Vwf	UTSW	6	125647768	missense
R7635:Vwf	UTSW	6	125682734	missense
R7793:Vwf	UTSW	6	125686520	missense
R7802:Vwf	UTSW	6	125666677	missense
R7824:Vwf	UTSW	6	125658815	missense
R7849:Vwf	UTSW	6	125656803	missense
R7900:Vwf	UTSW	6	125628476	critical splice donor site	probably null
R7919:Vwf	UTSW	6	125647859	missense
R7966:Vwf	UTSW	6	125639341	nonsense	probably null
R8101:Vwf	UTSW	6	125570559	nonsense	probably null
R8162:Vwf	UTSW	6	125645836	splice site	probably null
R8345:Vwf	UTSW	6	125679302	missense
X0021:Vwf	UTSW	6	125646331	missense	probably damaging	1.00
X0065:Vwf	UTSW	6	125603433	missense	probably null	0.05
Z1176:Vwf	UTSW	6	125591231	missense
Z1176:Vwf	UTSW	6	125603308	splice site	probably null

Predicted Primers

PCR Primer
(F):5'- TGAGACCACATTTCTGCTTGCTGC -3'
(R):5'- TTTGCACACCCTGTGACTAGGGAG -3'

Sequencing Primer
(F):5'- GCTTGCTGCAATCAAGAGTC -3'
(R):5'- GGGCTCTATGATAGTTTGACCC -3'

Posted On

2014-04-13