Incidental Mutation 'R1575:Zfp541'
ID 171092
Institutional Source Beutler Lab
Gene Symbol Zfp541
Ensembl Gene ENSMUSG00000078796
Gene Name zinc finger protein 541
Synonyms EG666528
MMRRC Submission 039613-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.684) question?
Stock # R1575 (G1)
Quality Score 109
Status Validated
Chromosome 7
Chromosomal Location 16061814-16096334 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 16078715 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Valine to Alanine at position 431 (V431A)
Ref Sequence ENSEMBL: ENSMUSP00000148143 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000108509] [ENSMUST00000209369] [ENSMUST00000210805]
AlphaFold Q0GGX2
Predicted Effect possibly damaging
Transcript: ENSMUST00000108509
AA Change: V431A

PolyPhen 2 Score 0.936 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000104149
Gene: ENSMUSG00000078796
AA Change: V431A

DomainStartEndE-ValueType
low complexity region 48 65 N/A INTRINSIC
ZnF_C2H2 140 162 2.24e-3 SMART
ZnF_C2H2 168 190 4.47e-3 SMART
ZnF_C2H2 196 221 2.36e-2 SMART
low complexity region 249 260 N/A INTRINSIC
low complexity region 362 374 N/A INTRINSIC
low complexity region 444 465 N/A INTRINSIC
low complexity region 473 484 N/A INTRINSIC
low complexity region 594 609 N/A INTRINSIC
low complexity region 659 670 N/A INTRINSIC
ZnF_C2H2 838 860 3.72e0 SMART
low complexity region 953 958 N/A INTRINSIC
ELM2 1065 1122 4.46e-14 SMART
SANT 1171 1219 8.38e-7 SMART
low complexity region 1252 1263 N/A INTRINSIC
ZnF_C2H2 1301 1323 1.01e-1 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000209369
AA Change: V431A

PolyPhen 2 Score 0.936 (Sensitivity: 0.80; Specificity: 0.94)
Predicted Effect possibly damaging
Transcript: ENSMUST00000210805
AA Change: V431A

PolyPhen 2 Score 0.936 (Sensitivity: 0.80; Specificity: 0.94)
Meta Mutation Damage Score 0.0738 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.2%
  • 10x: 96.0%
  • 20x: 91.5%
Validation Efficiency 100% (72/72)
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrl2 T A 3: 148,852,762 T437S probably benign Het
Akna A G 4: 63,379,333 F828S probably benign Het
Alg9 G T 9: 50,775,502 A40S possibly damaging Het
Alox8 T A 11: 69,185,241 H628L possibly damaging Het
Aox3 T C 1: 58,152,554 W422R probably benign Het
Atp13a4 T C 16: 29,409,710 D984G probably benign Het
Bcam T C 7: 19,760,382 E363G possibly damaging Het
Cadps2 C A 6: 23,429,218 V519F probably damaging Het
Calca A G 7: 114,635,161 Y18H probably damaging Het
Cd70 A G 17: 57,146,364 I100T probably damaging Het
Cdk4 T A 10: 127,064,651 H95Q probably damaging Het
Chchd1 T A 14: 20,703,342 N11K probably damaging Het
Cma2 T A 14: 55,972,815 N52K probably damaging Het
Cyp3a16 A G 5: 145,436,457 V500A probably benign Het
Dicer1 A G 12: 104,721,969 probably null Het
Dnajc13 A G 9: 104,156,838 S2206P probably benign Het
Dtl T C 1: 191,561,546 probably null Het
Fam186b T C 15: 99,286,971 T24A probably benign Het
Fbxw21 A G 9: 109,161,916 V25A probably benign Het
Gins1 T C 2: 150,912,838 S45P probably benign Het
Gtpbp2 T A 17: 46,165,943 V349D probably damaging Het
Hyal5 G T 6: 24,876,793 D222Y probably damaging Het
Itgal A G 7: 127,300,888 probably null Het
Klk14 A G 7: 43,693,953 probably null Het
Lama1 T A 17: 67,810,409 L2518Q possibly damaging Het
Lrrc2 G A 9: 110,979,487 G264D probably benign Het
Ltbp4 A G 7: 27,322,820 S893P probably damaging Het
Mast4 G A 13: 102,739,263 P1107L probably damaging Het
Mbd1 T A 18: 74,275,419 probably null Het
Naip2 A T 13: 100,155,021 D1136E probably benign Het
Naip2 G A 13: 100,155,029 probably benign Het
Ncan G A 8: 70,110,198 T470I probably benign Het
Npy1r A T 8: 66,704,161 I78F probably damaging Het
Olfr1491 A T 19: 13,705,525 M233L probably benign Het
Olfr917 G A 9: 38,665,277 T189M probably damaging Het
Palb2 A T 7: 122,110,838 probably null Het
Pax3 T C 1: 78,103,484 T422A probably benign Het
Pebp1 A T 5: 117,286,164 D72E possibly damaging Het
Pnliprp1 A T 19: 58,740,469 T363S probably benign Het
Rbm44 G A 1: 91,156,843 probably null Het
Rbm47 T A 5: 66,025,015 Y425F probably benign Het
Robo3 G T 9: 37,429,661 A83E probably damaging Het
Rrm1 A G 7: 102,456,514 Y279C probably damaging Het
Rslcan18 A T 13: 67,108,057 probably benign Het
Scara5 C A 14: 65,730,865 Q196K probably benign Het
Setd1b C T 5: 123,163,147 probably benign Het
Siah1a A G 8: 86,725,241 F205S probably damaging Het
Smr2 AT ATT 5: 88,108,824 probably null Het
Ssu72 A G 4: 155,731,357 D86G probably benign Het
St7 G T 6: 17,886,111 K357N probably damaging Het
Sv2b G A 7: 75,147,677 T323I probably damaging Het
Syt1 T C 10: 108,504,500 N319S probably benign Het
Tanc1 T A 2: 59,791,651 F371L probably damaging Het
Tcf20 C A 15: 82,855,492 G586V probably benign Het
Tg T C 15: 66,729,685 probably null Het
Tyk2 A T 9: 21,115,462 N620K probably benign Het
Ube2j1 T A 4: 33,045,116 S130T probably benign Het
Ubr2 G T 17: 46,932,492 P1696H probably damaging Het
Ubr5 A T 15: 38,040,841 D266E probably damaging Het
Vipr2 A G 12: 116,144,272 T426A probably benign Het
Vmn2r104 A T 17: 20,042,215 W218R probably damaging Het
Vmn2r83 T A 10: 79,479,122 N401K probably damaging Het
Vwf A G 6: 125,655,251 E82G unknown Het
Vwf T A 6: 125,663,571 Y2323* probably null Het
Wdr76 T G 2: 121,528,921 V329G probably damaging Het
Zan A G 5: 137,461,952 C1226R unknown Het
Zbtb16 G T 9: 48,832,272 Q247K probably damaging Het
Other mutations in Zfp541
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02162:Zfp541 APN 7 16079468 missense possibly damaging 0.80
IGL02262:Zfp541 APN 7 16079695 missense probably damaging 1.00
IGL02347:Zfp541 APN 7 16083465 missense probably damaging 1.00
IGL02516:Zfp541 APN 7 16082993 splice site probably null
R0101:Zfp541 UTSW 7 16078043 missense probably damaging 1.00
R0412:Zfp541 UTSW 7 16082174 missense possibly damaging 0.88
R0627:Zfp541 UTSW 7 16095682 splice site probably benign
R0784:Zfp541 UTSW 7 16082992 intron probably benign
R1083:Zfp541 UTSW 7 16078712 missense probably benign 0.16
R1541:Zfp541 UTSW 7 16078512 missense probably benign 0.04
R1730:Zfp541 UTSW 7 16077973 missense probably damaging 0.99
R1783:Zfp541 UTSW 7 16077973 missense probably damaging 0.99
R1966:Zfp541 UTSW 7 16079071 missense probably benign 0.02
R2022:Zfp541 UTSW 7 16082185 missense probably damaging 1.00
R2048:Zfp541 UTSW 7 16078327 missense possibly damaging 0.94
R2436:Zfp541 UTSW 7 16076448 missense possibly damaging 0.94
R3973:Zfp541 UTSW 7 16072222 missense probably damaging 1.00
R4081:Zfp541 UTSW 7 16072135 missense probably benign 0.16
R4589:Zfp541 UTSW 7 16083336 missense probably benign 0.35
R4724:Zfp541 UTSW 7 16081687 missense probably damaging 0.99
R4812:Zfp541 UTSW 7 16079110 missense probably benign 0.01
R4817:Zfp541 UTSW 7 16090382 missense probably damaging 1.00
R5232:Zfp541 UTSW 7 16095179 missense probably damaging 1.00
R5331:Zfp541 UTSW 7 16095758 missense probably damaging 1.00
R5551:Zfp541 UTSW 7 16090861 missense probably damaging 1.00
R5976:Zfp541 UTSW 7 16076419 missense probably benign 0.34
R6259:Zfp541 UTSW 7 16095526 missense probably benign 0.02
R6523:Zfp541 UTSW 7 16095520 missense probably damaging 1.00
R6826:Zfp541 UTSW 7 16078982 missense probably damaging 0.96
R7319:Zfp541 UTSW 7 16079369 missense probably benign 0.21
R7428:Zfp541 UTSW 7 16092868 missense probably damaging 1.00
R7594:Zfp541 UTSW 7 16076386 missense probably damaging 0.96
R7724:Zfp541 UTSW 7 16071994 missense probably damaging 1.00
R8276:Zfp541 UTSW 7 16079084 missense possibly damaging 0.87
R8433:Zfp541 UTSW 7 16072074 missense probably benign 0.16
R9068:Zfp541 UTSW 7 16078451 missense probably damaging 0.96
R9086:Zfp541 UTSW 7 16090404 missense probably damaging 1.00
R9132:Zfp541 UTSW 7 16083041 missense probably benign 0.45
R9261:Zfp541 UTSW 7 16082104 missense possibly damaging 0.94
R9408:Zfp541 UTSW 7 16072214 missense probably damaging 1.00
R9518:Zfp541 UTSW 7 16079111 missense possibly damaging 0.80
R9621:Zfp541 UTSW 7 16071967 missense possibly damaging 0.94
Z1088:Zfp541 UTSW 7 16079795 missense probably benign 0.16
Z1176:Zfp541 UTSW 7 16078266 missense probably damaging 1.00
Z1177:Zfp541 UTSW 7 16078763 missense probably damaging 1.00
Z1177:Zfp541 UTSW 7 16079029 missense probably benign 0.26
Z1177:Zfp541 UTSW 7 16082167 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- AGTCAGAGTCTCCACGGCTTCAAC -3'
(R):5'- GGACTTGGCAATCATCTGGAGCAC -3'

Sequencing Primer
(F):5'- CGGCTTCAACGGCCATC -3'
(R):5'- GGCTTACTAGAGACTCCTGTGAC -3'
Posted On 2014-04-13