Incidental Mutation 'R1655:Atcay'
ID 189040
Institutional Source Beutler Lab
Gene Symbol Atcay
Ensembl Gene ENSMUSG00000034958
Gene Name ataxia, cerebellar, Cayman type
Synonyms 3322401A10Rik, ji, BNIP-H
MMRRC Submission 039691-MU
Accession Numbers

Genbank: NM_178662; MGI: 2448730
Essential gene? Probably non essential (E-score: 0.104) question?
Stock # R1655 (G1)
Quality Score 225
Status Not validated
Chromosome 10
Chromosomal Location 81204508-81230833 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) C to T at 81213397 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Valine to Methionine at position 124 (V124M)
Ref Sequence ENSEMBL: ENSMUSP00000036721 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000047408] [ENSMUST00000146030]
AlphaFold Q8BHE3
Predicted Effect probably damaging
Transcript: ENSMUST00000047408
AA Change: V124M

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000036721
Gene: ENSMUSG00000034958
AA Change: V124M

DomainStartEndE-ValueType
Pfam:BNIP2 59 187 7.7e-47 PFAM
Pfam:CRAL_TRIO_2 188 326 8.6e-35 PFAM
Pfam:CRAL_TRIO 205 318 5.3e-10 PFAM
low complexity region 352 369 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129950
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133555
Predicted Effect probably benign
Transcript: ENSMUST00000146030
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150782
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.0%
  • 20x: 91.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a neuron-restricted protein that contains a CRAL-TRIO motif common to proteins that bind small lipophilic molecules. Mutations in this gene are associated with cerebellar ataxia, Cayman type. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mutants homozygous for a severe allele show progressive impaired coordination and seizures beginning by 10-16 days of age and die by 4 weeks of age. Homozygotes for milder alleles have abnormal gait, slightly diminished body size and reduced male fertility. [provided by MGI curators]
Allele List at MGI
All alleles(6) : Gene trapped(1) Spontaneous(4) Chemically induced(1)
Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4833427G06Rik A T 9: 51,083,621 I136N probably damaging Het
9530053A07Rik A T 7: 28,147,110 N1076Y probably damaging Het
A730061H03Rik A T 14: 55,560,333 probably benign Het
Abca1 C T 4: 53,050,964 A1582T probably benign Het
Acot8 A T 2: 164,803,108 S52T probably benign Het
Cep295 C T 9: 15,340,883 E397K probably damaging Het
Cfap46 A T 7: 139,642,520 Y1180* probably null Het
Clptm1 T A 7: 19,645,867 H148L probably benign Het
Clstn3 A G 6: 124,437,427 L743P probably damaging Het
Crtc3 A T 7: 80,598,776 M313K possibly damaging Het
Csgalnact1 T A 8: 68,373,689 I326F possibly damaging Het
Dennd6b G T 15: 89,196,340 T19K unknown Het
Disp1 A T 1: 183,087,004 I1284N probably benign Het
Dnah2 A G 11: 69,473,854 Y1992H probably damaging Het
Dnah6 C T 6: 73,205,732 V205I possibly damaging Het
Dst G T 1: 34,282,576 G4391* probably null Het
Dytn A G 1: 63,661,198 S258P probably damaging Het
Emilin3 T A 2: 160,910,866 probably null Het
Ermn C T 2: 58,052,584 V45I probably benign Het
Fat4 T C 3: 38,957,318 V2189A probably damaging Het
Filip1l T C 16: 57,571,851 I934T probably damaging Het
Gbp9 T A 5: 105,081,692 Q472L possibly damaging Het
Gimap5 G T 6: 48,753,176 E227* probably null Het
Gsdmc C T 15: 63,780,043 V240M probably benign Het
H2-Q4 G T 17: 35,382,905 V248F probably damaging Het
Helz2 T C 2: 181,234,147 E1518G probably damaging Het
Hmcn1 A G 1: 150,630,333 V3814A probably benign Het
Ifna7 A G 4: 88,816,660 T145A probably benign Het
Itgam T A 7: 128,115,163 M947K probably benign Het
Itpr2 T G 6: 146,376,148 N608H probably damaging Het
Klra2 T A 6: 131,220,211 N242I probably damaging Het
Lonrf2 A T 1: 38,811,824 L219Q probably damaging Het
Ly6c2 T C 15: 75,108,563 I126V probably benign Het
Mr1 G A 1: 155,132,455 T258M probably benign Het
Mrps35 T G 6: 147,060,228 D200E possibly damaging Het
Nbeal2 A C 9: 110,632,872 S1506A probably damaging Het
Ncoa7 T C 10: 30,698,245 probably null Het
Nlrp4a A T 7: 26,449,651 I228F possibly damaging Het
Olfr1047 A G 2: 86,228,080 V297A possibly damaging Het
Olfr1339 A G 4: 118,734,999 S157G probably benign Het
Olfr368 A G 2: 37,331,939 Y64C probably damaging Het
Olfr483 A T 7: 108,103,464 I52F probably damaging Het
Paxx T C 2: 25,460,316 E93G probably damaging Het
Per2 C A 1: 91,448,768 G128W probably damaging Het
Piezo1 A G 8: 122,496,822 I796T probably benign Het
Pkhd1 A G 1: 20,584,129 S235P probably damaging Het
Pole T A 5: 110,335,922 F259Y probably damaging Het
Pus7 T A 5: 23,747,800 K512* probably null Het
Ralyl A T 3: 14,107,236 Y55F probably damaging Het
Rgs14 T A 13: 55,383,534 M451K probably benign Het
Rhag T C 17: 40,831,596 F231L probably damaging Het
Ric8a T C 7: 140,860,895 C94R probably benign Het
Rictor T A 15: 6,772,212 D460E probably benign Het
Rpn1 T C 6: 88,100,944 V454A possibly damaging Het
Sacs A G 14: 61,191,782 D427G probably benign Het
Scai A T 2: 39,080,117 V545D possibly damaging Het
Serpinb3a A G 1: 107,046,212 V323A probably damaging Het
Slc13a5 C A 11: 72,257,378 C277F probably benign Het
Slc15a1 A T 14: 121,465,899 Y557N probably benign Het
Slc34a2 T C 5: 53,069,419 V628A probably benign Het
Slc8a2 G T 7: 16,141,135 G436V probably damaging Het
Sphkap G A 1: 83,277,515 R838* probably null Het
Supt5 T C 7: 28,330,024 I103V probably benign Het
Tdrd1 T A 19: 56,843,216 Y346* probably null Het
Tg T G 15: 66,828,568 probably null Het
Top1 T A 2: 160,703,696 probably null Het
Trmt12 T C 15: 58,873,227 L158P probably damaging Het
Tssk4 A G 14: 55,651,695 N226S probably damaging Het
Unc80 G T 1: 66,672,756 V2746F possibly damaging Het
Usp34 T A 11: 23,375,051 V999E probably benign Het
Virma T C 4: 11,494,786 V29A probably damaging Het
Zfp40 A T 17: 23,177,266 Y48N probably benign Het
Zfp609 A G 9: 65,703,554 V709A possibly damaging Het
Other mutations in Atcay
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02231:Atcay APN 10 81210548 missense probably damaging 1.00
IGL03493:Atcay APN 10 81210573 nonsense probably null
wobbley UTSW 10 81220573 intron probably benign
PIT4453001:Atcay UTSW 10 81210549 missense probably damaging 0.99
R0040:Atcay UTSW 10 81210519 splice site probably null
R0040:Atcay UTSW 10 81210519 splice site probably null
R0113:Atcay UTSW 10 81214720 critical splice donor site probably null
R0441:Atcay UTSW 10 81224460 missense possibly damaging 0.71
R1709:Atcay UTSW 10 81213231 missense probably damaging 1.00
R1955:Atcay UTSW 10 81214793 missense possibly damaging 0.95
R1968:Atcay UTSW 10 81212478 missense possibly damaging 0.65
R2298:Atcay UTSW 10 81210563 missense probably damaging 1.00
R4472:Atcay UTSW 10 81212527 missense possibly damaging 0.78
R6265:Atcay UTSW 10 81213280 missense possibly damaging 0.94
R6322:Atcay UTSW 10 81213291 missense probably damaging 0.98
R7251:Atcay UTSW 10 81210532 nonsense probably null
R7381:Atcay UTSW 10 81210597 missense possibly damaging 0.61
R8277:Atcay UTSW 10 81214812 missense probably damaging 1.00
R8403:Atcay UTSW 10 81212948 missense probably damaging 1.00
R8859:Atcay UTSW 10 81224464 missense probably benign 0.01
R9542:Atcay UTSW 10 81207852 missense unknown
Predicted Primers PCR Primer
(F):5'- AGAAGACCCTTGACAGAACCCTGG -3'
(R):5'- AACCCTGAGTGGGCTTCATTATGC -3'

Sequencing Primer
(F):5'- AGAACCCTGGTCGCTGTG -3'
(R):5'- GCTTCATTATGCTGGGCAAG -3'
Posted On 2014-05-09