Incidental Mutation 'R1655:Rpn1'
ID 189018
Institutional Source Beutler Lab
Gene Symbol Rpn1
Ensembl Gene ENSMUSG00000030062
Gene Name ribophorin I
Synonyms D6Wsu137e, Rpn-1
MMRRC Submission 039691-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.962) question?
Stock # R1655 (G1)
Quality Score 225
Status Not validated
Chromosome 6
Chromosomal Location 88084482-88105304 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 88100944 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Valine to Alanine at position 454 (V454A)
Ref Sequence ENSEMBL: ENSMUSP00000032143 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032143]
AlphaFold Q91YQ5
Predicted Effect possibly damaging
Transcript: ENSMUST00000032143
AA Change: V454A

PolyPhen 2 Score 0.783 (Sensitivity: 0.85; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000032143
Gene: ENSMUSG00000030062
AA Change: V454A

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
Pfam:Ribophorin_I 32 458 4.2e-149 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000185149
Predicted Effect noncoding transcript
Transcript: ENSMUST00000203813
Predicted Effect noncoding transcript
Transcript: ENSMUST00000204024
Predicted Effect noncoding transcript
Transcript: ENSMUST00000204164
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.0%
  • 20x: 91.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a type I integral membrane protein found only in the rough endoplasmic reticulum. The encoded protein is part of an N-oligosaccharyl transferase complex that links high mannose oligosaccharides to asparagine residues found in the Asn-X-Ser/Thr consensus motif of nascent polypeptide chains. This protein forms part of the regulatory subunit of the 26S proteasome and may mediate binding of ubiquitin-like domains to this proteasome. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A730061H03Rik A T 14: 55,560,333 (GRCm38) probably benign Het
Abca1 C T 4: 53,050,964 (GRCm38) A1582T probably benign Het
Acot8 A T 2: 164,803,108 (GRCm38) S52T probably benign Het
Atcay C T 10: 81,213,397 (GRCm38) V124M probably damaging Het
Cep295 C T 9: 15,340,883 (GRCm38) E397K probably damaging Het
Cfap46 A T 7: 139,642,520 (GRCm38) Y1180* probably null Het
Clptm1 T A 7: 19,645,867 (GRCm38) H148L probably benign Het
Clstn3 A G 6: 124,437,427 (GRCm38) L743P probably damaging Het
Crtc3 A T 7: 80,598,776 (GRCm38) M313K possibly damaging Het
Csgalnact1 T A 8: 68,373,689 (GRCm38) I326F possibly damaging Het
Dennd6b G T 15: 89,196,340 (GRCm38) T19K unknown Het
Disp1 A T 1: 183,087,004 (GRCm38) I1284N probably benign Het
Dnah2 A G 11: 69,473,854 (GRCm38) Y1992H probably damaging Het
Dnah6 C T 6: 73,205,732 (GRCm38) V205I possibly damaging Het
Dst G T 1: 34,282,576 (GRCm38) G4391* probably null Het
Dytn A G 1: 63,661,198 (GRCm38) S258P probably damaging Het
Emilin3 T A 2: 160,910,866 (GRCm38) probably null Het
Ermn C T 2: 58,052,584 (GRCm38) V45I probably benign Het
Fat4 T C 3: 38,957,318 (GRCm38) V2189A probably damaging Het
Fcgbpl1 A T 7: 28,147,110 (GRCm38) N1076Y probably damaging Het
Filip1l T C 16: 57,571,851 (GRCm38) I934T probably damaging Het
Gbp9 T A 5: 105,081,692 (GRCm38) Q472L possibly damaging Het
Gimap5 G T 6: 48,753,176 (GRCm38) E227* probably null Het
Gsdmc C T 15: 63,780,043 (GRCm38) V240M probably benign Het
H2-Q4 G T 17: 35,382,905 (GRCm38) V248F probably damaging Het
Helz2 T C 2: 181,234,147 (GRCm38) E1518G probably damaging Het
Hmcn1 A G 1: 150,630,333 (GRCm38) V3814A probably benign Het
Hoatz A T 9: 51,083,621 (GRCm38) I136N probably damaging Het
Ifna7 A G 4: 88,816,660 (GRCm38) T145A probably benign Het
Itgam T A 7: 128,115,163 (GRCm38) M947K probably benign Het
Itpr2 T G 6: 146,376,148 (GRCm38) N608H probably damaging Het
Klra2 T A 6: 131,220,211 (GRCm38) N242I probably damaging Het
Lonrf2 A T 1: 38,811,824 (GRCm38) L219Q probably damaging Het
Ly6c2 T C 15: 75,108,563 (GRCm38) I126V probably benign Het
Mr1 G A 1: 155,132,455 (GRCm38) T258M probably benign Het
Mrps35 T G 6: 147,060,228 (GRCm38) D200E possibly damaging Het
Nbeal2 A C 9: 110,632,872 (GRCm38) S1506A probably damaging Het
Ncoa7 T C 10: 30,698,245 (GRCm38) probably null Het
Nlrp4a A T 7: 26,449,651 (GRCm38) I228F possibly damaging Het
Or13p5 A G 4: 118,734,999 (GRCm38) S157G probably benign Het
Or5c1 A G 2: 37,331,939 (GRCm38) Y64C probably damaging Het
Or5p59 A T 7: 108,103,464 (GRCm38) I52F probably damaging Het
Or8k3 A G 2: 86,228,080 (GRCm38) V297A possibly damaging Het
Paxx T C 2: 25,460,316 (GRCm38) E93G probably damaging Het
Per2 C A 1: 91,448,768 (GRCm38) G128W probably damaging Het
Piezo1 A G 8: 122,496,822 (GRCm38) I796T probably benign Het
Pkhd1 A G 1: 20,584,129 (GRCm38) S235P probably damaging Het
Pole T A 5: 110,335,922 (GRCm38) F259Y probably damaging Het
Pus7 T A 5: 23,747,800 (GRCm38) K512* probably null Het
Ralyl A T 3: 14,107,236 (GRCm38) Y55F probably damaging Het
Rgs14 T A 13: 55,383,534 (GRCm38) M451K probably benign Het
Rhag T C 17: 40,831,596 (GRCm38) F231L probably damaging Het
Ric8a T C 7: 140,860,895 (GRCm38) C94R probably benign Het
Rictor T A 15: 6,772,212 (GRCm38) D460E probably benign Het
Sacs A G 14: 61,191,782 (GRCm38) D427G probably benign Het
Scai A T 2: 39,080,117 (GRCm38) V545D possibly damaging Het
Serpinb3a A G 1: 107,046,212 (GRCm38) V323A probably damaging Het
Slc13a5 C A 11: 72,257,378 (GRCm38) C277F probably benign Het
Slc15a1 A T 14: 121,465,899 (GRCm38) Y557N probably benign Het
Slc34a2 T C 5: 53,069,419 (GRCm38) V628A probably benign Het
Slc8a2 G T 7: 16,141,135 (GRCm38) G436V probably damaging Het
Sphkap G A 1: 83,277,515 (GRCm38) R838* probably null Het
Supt5 T C 7: 28,330,024 (GRCm38) I103V probably benign Het
Tdrd1 T A 19: 56,843,216 (GRCm38) Y346* probably null Het
Tg T G 15: 66,828,568 (GRCm38) probably null Het
Top1 T A 2: 160,703,696 (GRCm38) probably null Het
Trmt12 T C 15: 58,873,227 (GRCm38) L158P probably damaging Het
Tssk4 A G 14: 55,651,695 (GRCm38) N226S probably damaging Het
Unc80 G T 1: 66,672,756 (GRCm38) V2746F possibly damaging Het
Usp34 T A 11: 23,375,051 (GRCm38) V999E probably benign Het
Virma T C 4: 11,494,786 (GRCm38) V29A probably damaging Het
Zfp40 A T 17: 23,177,266 (GRCm38) Y48N probably benign Het
Zfp609 A G 9: 65,703,554 (GRCm38) V709A possibly damaging Het
Other mutations in Rpn1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00594:Rpn1 APN 6 88,095,629 (GRCm38) missense probably damaging 0.97
IGL02614:Rpn1 APN 6 88,102,105 (GRCm38) missense probably benign 0.03
R0101:Rpn1 UTSW 6 88,093,787 (GRCm38) missense possibly damaging 0.96
R0101:Rpn1 UTSW 6 88,093,787 (GRCm38) missense possibly damaging 0.96
R0505:Rpn1 UTSW 6 88,090,242 (GRCm38) missense probably benign 0.01
R1933:Rpn1 UTSW 6 88,093,859 (GRCm38) missense probably damaging 1.00
R1934:Rpn1 UTSW 6 88,093,859 (GRCm38) missense probably damaging 1.00
R1968:Rpn1 UTSW 6 88,095,548 (GRCm38) missense possibly damaging 0.87
R2020:Rpn1 UTSW 6 88,095,683 (GRCm38) missense probably damaging 1.00
R2074:Rpn1 UTSW 6 88,100,962 (GRCm38) missense probably damaging 1.00
R3237:Rpn1 UTSW 6 88,103,414 (GRCm38) missense probably benign 0.00
R3722:Rpn1 UTSW 6 88,090,300 (GRCm38) splice site probably null
R4837:Rpn1 UTSW 6 88,090,205 (GRCm38) missense probably benign 0.10
R5546:Rpn1 UTSW 6 88,093,859 (GRCm38) missense probably damaging 1.00
R6989:Rpn1 UTSW 6 88,099,303 (GRCm38) missense probably benign 0.02
R7292:Rpn1 UTSW 6 88,090,084 (GRCm38) missense probably damaging 1.00
R7296:Rpn1 UTSW 6 88,084,637 (GRCm38) missense possibly damaging 0.46
R7623:Rpn1 UTSW 6 88,084,568 (GRCm38) missense possibly damaging 0.96
R7816:Rpn1 UTSW 6 88,103,396 (GRCm38) missense possibly damaging 0.87
R7960:Rpn1 UTSW 6 88,102,086 (GRCm38) missense probably damaging 1.00
R8553:Rpn1 UTSW 6 88,095,557 (GRCm38) missense probably damaging 0.98
R8696:Rpn1 UTSW 6 88,103,377 (GRCm38) missense possibly damaging 0.68
R8831:Rpn1 UTSW 6 88,084,793 (GRCm38) missense probably benign 0.01
R9572:Rpn1 UTSW 6 88,102,012 (GRCm38) missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TCTCGTCGAGCAACACATTCAGG -3'
(R):5'- AGGGACAGAAGCTACTGCTGACAC -3'

Sequencing Primer
(F):5'- CAACACATTCAGGACATTGTGG -3'
(R):5'- TGACCTCACCTAGTGTCCAGG -3'
Posted On 2014-05-09