Mutagenetix > Incidental Mutations

Incidental Mutation 'R1655:Rpn1'

189018

Institutional Source

Beutler Lab

Gene Symbol

Rpn1

Ensembl Gene

ENSMUSG00000030062

Gene Name

ribophorin I

Synonyms

D6Wsu137e, Rpn-1

MMRRC Submission

039691-MU

Accession Numbers

Is this an essential gene?

Probably essential (E-score: 0.946) question?

Stock #

R1655 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

88084482-88105304 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 88100944 bp

Zygosity

Heterozygous

Amino Acid Change

Valine to Alanine at position 454 (V454A)

Ref Sequence

ENSEMBL: ENSMUSP00000032143 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000032143]

Predicted Effect

possibly damaging
Transcript: ENSMUST00000032143
AA Change: V454A

PolyPhen 2 Score 0.783 (Sensitivity: 0.85; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000032143
Gene: ENSMUSG00000030062
AA Change: V454A

Domain	Start	End	E-Value	Type
signal peptide	1	25	N/A	INTRINSIC
Pfam:Ribophorin_I	32	458	4.2e-149	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000185149

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000203813

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000204024

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000204164

Coding Region Coverage

1x: 99.1%
3x: 98.3%
10x: 96.0%
20x: 91.3%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a type I integral membrane protein found only in the rough endoplasmic reticulum. The encoded protein is part of an N-oligosaccharyl transferase complex that links high mannose oligosaccharides to asparagine residues found in the Asn-X-Ser/Thr consensus motif of nascent polypeptide chains. This protein forms part of the regulatory subunit of the 26S proteasome and may mediate binding of ubiquitin-like domains to this proteasome. [provided by RefSeq, Jul 2008]

Allele List at MGI

Other mutations in this stock

Total: 73 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4833427G06Rik	A	T	9: 51,083,621	I136N	probably damaging	Het
9530053A07Rik	A	T	7: 28,147,110	N1076Y	probably damaging	Het
A730061H03Rik	A	T	14: 55,560,333		probably benign	Het
Abca1	C	T	4: 53,050,964	A1582T	probably benign	Het
Acot8	A	T	2: 164,803,108	S52T	probably benign	Het
Atcay	C	T	10: 81,213,397	V124M	probably damaging	Het
Cep295	C	T	9: 15,340,883	E397K	probably damaging	Het
Cfap46	A	T	7: 139,642,520	Y1180*	probably null	Het
Clptm1	T	A	7: 19,645,867	H148L	probably benign	Het
Clstn3	A	G	6: 124,437,427	L743P	probably damaging	Het
Crtc3	A	T	7: 80,598,776	M313K	possibly damaging	Het
Csgalnact1	T	A	8: 68,373,689	I326F	possibly damaging	Het
Dennd6b	G	T	15: 89,196,340	T19K	unknown	Het
Disp1	A	T	1: 183,087,004	I1284N	probably benign	Het
Dnah2	A	G	11: 69,473,854	Y1992H	probably damaging	Het
Dnah6	C	T	6: 73,205,732	V205I	possibly damaging	Het
Dst	G	T	1: 34,282,576	G4391*	probably null	Het
Dytn	A	G	1: 63,661,198	S258P	probably damaging	Het
Emilin3	T	A	2: 160,910,866		probably null	Het
Ermn	C	T	2: 58,052,584	V45I	probably benign	Het
Fat4	T	C	3: 38,957,318	V2189A	probably damaging	Het
Filip1l	T	C	16: 57,571,851	I934T	probably damaging	Het
Gbp9	T	A	5: 105,081,692	Q472L	possibly damaging	Het
Gimap5	G	T	6: 48,753,176	E227*	probably null	Het
Gsdmc	C	T	15: 63,780,043	V240M	probably benign	Het
H2-Q4	G	T	17: 35,382,905	V248F	probably damaging	Het
Helz2	T	C	2: 181,234,147	E1518G	probably damaging	Het
Hmcn1	A	G	1: 150,630,333	V3814A	probably benign	Het
Ifna7	A	G	4: 88,816,660	T145A	probably benign	Het
Itgam	T	A	7: 128,115,163	M947K	probably benign	Het
Itpr2	T	G	6: 146,376,148	N608H	probably damaging	Het
Klra2	T	A	6: 131,220,211	N242I	probably damaging	Het
Lonrf2	A	T	1: 38,811,824	L219Q	probably damaging	Het
Ly6c2	T	C	15: 75,108,563	I126V	probably benign	Het
Mr1	G	A	1: 155,132,455	T258M	probably benign	Het
Mrps35	T	G	6: 147,060,228	D200E	possibly damaging	Het
Nbeal2	A	C	9: 110,632,872	S1506A	probably damaging	Het
Ncoa7	T	C	10: 30,698,245		probably null	Het
Nlrp4a	A	T	7: 26,449,651	I228F	possibly damaging	Het
Olfr1047	A	G	2: 86,228,080	V297A	possibly damaging	Het
Olfr1339	A	G	4: 118,734,999	S157G	probably benign	Het
Olfr368	A	G	2: 37,331,939	Y64C	probably damaging	Het
Olfr483	A	T	7: 108,103,464	I52F	probably damaging	Het
Paxx	T	C	2: 25,460,316	E93G	probably damaging	Het
Per2	C	A	1: 91,448,768	G128W	probably damaging	Het
Piezo1	A	G	8: 122,496,822	I796T	probably benign	Het
Pkhd1	A	G	1: 20,584,129	S235P	probably damaging	Het
Pole	T	A	5: 110,335,922	F259Y	probably damaging	Het
Pus7	T	A	5: 23,747,800	K512*	probably null	Het
Ralyl	A	T	3: 14,107,236	Y55F	probably damaging	Het
Rgs14	T	A	13: 55,383,534	M451K	probably benign	Het
Rhag	T	C	17: 40,831,596	F231L	probably damaging	Het
Ric8a	T	C	7: 140,860,895	C94R	probably benign	Het
Rictor	T	A	15: 6,772,212	D460E	probably benign	Het
Sacs	A	G	14: 61,191,782	D427G	probably benign	Het
Scai	A	T	2: 39,080,117	V545D	possibly damaging	Het
Serpinb3a	A	G	1: 107,046,212	V323A	probably damaging	Het
Slc13a5	C	A	11: 72,257,378	C277F	probably benign	Het
Slc15a1	A	T	14: 121,465,899	Y557N	probably benign	Het
Slc34a2	T	C	5: 53,069,419	V628A	probably benign	Het
Slc8a2	G	T	7: 16,141,135	G436V	probably damaging	Het
Sphkap	G	A	1: 83,277,515	R838*	probably null	Het
Supt5	T	C	7: 28,330,024	I103V	probably benign	Het
Tdrd1	T	A	19: 56,843,216	Y346*	probably null	Het
Tg	T	G	15: 66,828,568		probably null	Het
Top1	T	A	2: 160,703,696		probably null	Het
Trmt12	T	C	15: 58,873,227	L158P	probably damaging	Het
Tssk4	A	G	14: 55,651,695	N226S	probably damaging	Het
Unc80	G	T	1: 66,672,756	V2746F	possibly damaging	Het
Usp34	T	A	11: 23,375,051	V999E	probably benign	Het
Virma	T	C	4: 11,494,786	V29A	probably damaging	Het
Zfp40	A	T	17: 23,177,266	Y48N	probably benign	Het
Zfp609	A	G	9: 65,703,554	V709A	possibly damaging	Het

Other mutations in Rpn1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00594:Rpn1	APN	6	88095629	missense	probably damaging	0.97
IGL02614:Rpn1	APN	6	88102105	missense	probably benign	0.03
R0101:Rpn1	UTSW	6	88093787	missense	possibly damaging	0.96
R0101:Rpn1	UTSW	6	88093787	missense	possibly damaging	0.96
R0505:Rpn1	UTSW	6	88090242	missense	probably benign	0.01
R1933:Rpn1	UTSW	6	88093859	missense	probably damaging	1.00
R1934:Rpn1	UTSW	6	88093859	missense	probably damaging	1.00
R1968:Rpn1	UTSW	6	88095548	missense	possibly damaging	0.87
R2020:Rpn1	UTSW	6	88095683	missense	probably damaging	1.00
R2074:Rpn1	UTSW	6	88100962	missense	probably damaging	1.00
R3237:Rpn1	UTSW	6	88103414	missense	probably benign	0.00
R3722:Rpn1	UTSW	6	88090300	splice site	probably null
R4837:Rpn1	UTSW	6	88090205	missense	probably benign	0.10
R5546:Rpn1	UTSW	6	88093859	missense	probably damaging	1.00
R6989:Rpn1	UTSW	6	88099303	missense	probably benign	0.02
R7292:Rpn1	UTSW	6	88090084	missense	probably damaging	1.00
R7296:Rpn1	UTSW	6	88084637	missense	possibly damaging	0.46
R7623:Rpn1	UTSW	6	88084568	missense	possibly damaging	0.96

Predicted Primers

PCR Primer
(F):5'- TCTCGTCGAGCAACACATTCAGG -3'
(R):5'- AGGGACAGAAGCTACTGCTGACAC -3'

Sequencing Primer
(F):5'- CAACACATTCAGGACATTGTGG -3'
(R):5'- TGACCTCACCTAGTGTCCAGG -3'

Posted On

2014-05-09