Incidental Mutation 'R1655:9530053A07Rik'
ID189026
Institutional Source Beutler Lab
Gene Symbol 9530053A07Rik
Ensembl Gene ENSMUSG00000078776
Gene NameRIKEN cDNA 9530053A07 gene
Synonyms
MMRRC Submission 039691-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.126) question?
Stock #R1655 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location28129466-28164811 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 28147110 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Tyrosine at position 1076 (N1076Y)
Ref Sequence ENSEMBL: ENSMUSP00000114986 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000059886] [ENSMUST00000150948]
Predicted Effect probably damaging
Transcript: ENSMUST00000059886
AA Change: N1076Y

PolyPhen 2 Score 0.976 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000056479
Gene: ENSMUSG00000078776
AA Change: N1076Y

DomainStartEndE-ValueType
low complexity region 8 24 N/A INTRINSIC
FOLN 27 49 1.23e-4 SMART
VWD 46 211 1.5e-40 SMART
C8 251 326 4.31e-33 SMART
Pfam:TIL 329 383 2e-13 PFAM
VWC 385 448 1.02e0 SMART
VWD 439 603 4.32e-32 SMART
C8 640 715 4.54e-9 SMART
Pfam:TIL 718 771 1.6e-12 PFAM
VWC 773 826 1.1e0 SMART
FOLN 805 827 6.87e1 SMART
VWD 825 988 7.92e-40 SMART
C8 1033 1108 5.1e-35 SMART
Pfam:TIL 1111 1164 7.6e-11 PFAM
VWC 1166 1224 1.1e-2 SMART
FOLN 1197 1219 9.55e-1 SMART
FOLN 1223 1245 5.38e1 SMART
VWD 1241 1410 9.04e-35 SMART
C8 1450 1526 9.54e-26 SMART
low complexity region 1540 1550 N/A INTRINSIC
EGF_like 1557 1580 5.34e1 SMART
VWC 1588 1681 3.21e-3 SMART
VWD 1639 1806 7.3e-30 SMART
C8 1838 1913 2.44e-32 SMART
EGF_like 1941 1964 4.46e1 SMART
VWC 1971 2062 2.85e-1 SMART
VWD 2022 2178 1.32e-27 SMART
low complexity region 2199 2212 N/A INTRINSIC
C8 2219 2294 1.43e-29 SMART
Pfam:TIL 2297 2350 1.1e-11 PFAM
FOLN 2383 2405 5.68e1 SMART
VWD 2402 2564 4.58e-4 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129051
Predicted Effect probably damaging
Transcript: ENSMUST00000150948
AA Change: N1076Y

PolyPhen 2 Score 0.976 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000114986
Gene: ENSMUSG00000078776
AA Change: N1076Y

DomainStartEndE-ValueType
low complexity region 8 24 N/A INTRINSIC
FOLN 27 49 1.23e-4 SMART
VWD 46 211 1.5e-40 SMART
C8 251 326 4.31e-33 SMART
Pfam:TIL 329 383 2e-13 PFAM
VWC 385 448 1.02e0 SMART
VWD 439 603 4.32e-32 SMART
C8 640 715 4.54e-9 SMART
Pfam:TIL 718 771 1.6e-12 PFAM
VWC 773 826 1.1e0 SMART
FOLN 805 827 6.87e1 SMART
VWD 825 988 7.92e-40 SMART
C8 1033 1108 5.1e-35 SMART
Pfam:TIL 1111 1164 7.6e-11 PFAM
VWC 1166 1224 1.1e-2 SMART
FOLN 1197 1219 9.55e-1 SMART
FOLN 1223 1245 5.38e1 SMART
VWD 1241 1410 9.04e-35 SMART
C8 1450 1526 9.54e-26 SMART
low complexity region 1540 1550 N/A INTRINSIC
EGF_like 1557 1580 5.34e1 SMART
VWC 1588 1681 3.21e-3 SMART
VWD 1639 1806 7.3e-30 SMART
C8 1838 1913 2.44e-32 SMART
EGF_like 1941 1964 4.46e1 SMART
VWC 1971 2062 2.85e-1 SMART
VWD 2022 2178 1.32e-27 SMART
low complexity region 2199 2212 N/A INTRINSIC
C8 2219 2294 1.43e-29 SMART
Pfam:TIL 2297 2350 1.1e-11 PFAM
FOLN 2383 2405 5.68e1 SMART
VWD 2402 2564 4.58e-4 SMART
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.0%
  • 20x: 91.3%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4833427G06Rik A T 9: 51,083,621 I136N probably damaging Het
A730061H03Rik A T 14: 55,560,333 probably benign Het
Abca1 C T 4: 53,050,964 A1582T probably benign Het
Acot8 A T 2: 164,803,108 S52T probably benign Het
Atcay C T 10: 81,213,397 V124M probably damaging Het
Cep295 C T 9: 15,340,883 E397K probably damaging Het
Cfap46 A T 7: 139,642,520 Y1180* probably null Het
Clptm1 T A 7: 19,645,867 H148L probably benign Het
Clstn3 A G 6: 124,437,427 L743P probably damaging Het
Crtc3 A T 7: 80,598,776 M313K possibly damaging Het
Csgalnact1 T A 8: 68,373,689 I326F possibly damaging Het
Dennd6b G T 15: 89,196,340 T19K unknown Het
Disp1 A T 1: 183,087,004 I1284N probably benign Het
Dnah2 A G 11: 69,473,854 Y1992H probably damaging Het
Dnah6 C T 6: 73,205,732 V205I possibly damaging Het
Dst G T 1: 34,282,576 G4391* probably null Het
Dytn A G 1: 63,661,198 S258P probably damaging Het
Emilin3 T A 2: 160,910,866 probably null Het
Ermn C T 2: 58,052,584 V45I probably benign Het
Fat4 T C 3: 38,957,318 V2189A probably damaging Het
Filip1l T C 16: 57,571,851 I934T probably damaging Het
Gbp9 T A 5: 105,081,692 Q472L possibly damaging Het
Gimap5 G T 6: 48,753,176 E227* probably null Het
Gsdmc C T 15: 63,780,043 V240M probably benign Het
H2-Q4 G T 17: 35,382,905 V248F probably damaging Het
Helz2 T C 2: 181,234,147 E1518G probably damaging Het
Hmcn1 A G 1: 150,630,333 V3814A probably benign Het
Ifna7 A G 4: 88,816,660 T145A probably benign Het
Itgam T A 7: 128,115,163 M947K probably benign Het
Itpr2 T G 6: 146,376,148 N608H probably damaging Het
Klra2 T A 6: 131,220,211 N242I probably damaging Het
Lonrf2 A T 1: 38,811,824 L219Q probably damaging Het
Ly6c2 T C 15: 75,108,563 I126V probably benign Het
Mr1 G A 1: 155,132,455 T258M probably benign Het
Mrps35 T G 6: 147,060,228 D200E possibly damaging Het
Nbeal2 A C 9: 110,632,872 S1506A probably damaging Het
Ncoa7 T C 10: 30,698,245 probably null Het
Nlrp4a A T 7: 26,449,651 I228F possibly damaging Het
Olfr1047 A G 2: 86,228,080 V297A possibly damaging Het
Olfr1339 A G 4: 118,734,999 S157G probably benign Het
Olfr368 A G 2: 37,331,939 Y64C probably damaging Het
Olfr483 A T 7: 108,103,464 I52F probably damaging Het
Paxx T C 2: 25,460,316 E93G probably damaging Het
Per2 C A 1: 91,448,768 G128W probably damaging Het
Piezo1 A G 8: 122,496,822 I796T probably benign Het
Pkhd1 A G 1: 20,584,129 S235P probably damaging Het
Pole T A 5: 110,335,922 F259Y probably damaging Het
Pus7 T A 5: 23,747,800 K512* probably null Het
Ralyl A T 3: 14,107,236 Y55F probably damaging Het
Rgs14 T A 13: 55,383,534 M451K probably benign Het
Rhag T C 17: 40,831,596 F231L probably damaging Het
Ric8a T C 7: 140,860,895 C94R probably benign Het
Rictor T A 15: 6,772,212 D460E probably benign Het
Rpn1 T C 6: 88,100,944 V454A possibly damaging Het
Sacs A G 14: 61,191,782 D427G probably benign Het
Scai A T 2: 39,080,117 V545D possibly damaging Het
Serpinb3a A G 1: 107,046,212 V323A probably damaging Het
Slc13a5 C A 11: 72,257,378 C277F probably benign Het
Slc15a1 A T 14: 121,465,899 Y557N probably benign Het
Slc34a2 T C 5: 53,069,419 V628A probably benign Het
Slc8a2 G T 7: 16,141,135 G436V probably damaging Het
Sphkap G A 1: 83,277,515 R838* probably null Het
Supt5 T C 7: 28,330,024 I103V probably benign Het
Tdrd1 T A 19: 56,843,216 Y346* probably null Het
Tg T G 15: 66,828,568 probably null Het
Top1 T A 2: 160,703,696 probably null Het
Trmt12 T C 15: 58,873,227 L158P probably damaging Het
Tssk4 A G 14: 55,651,695 N226S probably damaging Het
Unc80 G T 1: 66,672,756 V2746F possibly damaging Het
Usp34 T A 11: 23,375,051 V999E probably benign Het
Virma T C 4: 11,494,786 V29A probably damaging Het
Zfp40 A T 17: 23,177,266 Y48N probably benign Het
Zfp609 A G 9: 65,703,554 V709A possibly damaging Het
Other mutations in 9530053A07Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00435:9530053A07Rik APN 7 28164528 missense probably damaging 1.00
IGL00757:9530053A07Rik APN 7 28154445 missense probably damaging 1.00
IGL01015:9530053A07Rik APN 7 28155318 missense probably damaging 1.00
IGL01079:9530053A07Rik APN 7 28139778 missense probably damaging 0.99
IGL01343:9530053A07Rik APN 7 28150702 missense probably benign 0.19
IGL01420:9530053A07Rik APN 7 28140133 missense probably benign 0.28
IGL01604:9530053A07Rik APN 7 28155324 missense probably benign 0.11
IGL01666:9530053A07Rik APN 7 28153292 missense probably damaging 1.00
IGL02002:9530053A07Rik APN 7 28152796 missense probably damaging 1.00
IGL02036:9530053A07Rik APN 7 28137525 missense possibly damaging 0.82
IGL02126:9530053A07Rik APN 7 28139856 missense probably damaging 1.00
IGL02150:9530053A07Rik APN 7 28146779 nonsense probably null
IGL02219:9530053A07Rik APN 7 28154635 missense probably damaging 1.00
IGL02563:9530053A07Rik APN 7 28157892 missense probably benign
IGL02804:9530053A07Rik APN 7 28153370 missense probably benign 0.00
IGL02830:9530053A07Rik APN 7 28162923 missense probably damaging 1.00
IGL02943:9530053A07Rik APN 7 28147188 missense probably damaging 1.00
IGL02977:9530053A07Rik APN 7 28164372 missense possibly damaging 0.83
IGL03231:9530053A07Rik APN 7 28153722 missense possibly damaging 0.95
IGL03304:9530053A07Rik APN 7 28142242 missense probably damaging 0.99
PIT4378001:9530053A07Rik UTSW 7 28154464 missense possibly damaging 0.61
R0023:9530053A07Rik UTSW 7 28153412 missense probably benign 0.00
R0131:9530053A07Rik UTSW 7 28137615 missense probably damaging 1.00
R0131:9530053A07Rik UTSW 7 28137615 missense probably damaging 1.00
R0132:9530053A07Rik UTSW 7 28137615 missense probably damaging 1.00
R0158:9530053A07Rik UTSW 7 28155492 missense probably damaging 1.00
R0230:9530053A07Rik UTSW 7 28156825 missense probably damaging 1.00
R0310:9530053A07Rik UTSW 7 28142274 missense probably benign 0.04
R0448:9530053A07Rik UTSW 7 28140235 missense probably benign 0.03
R0462:9530053A07Rik UTSW 7 28137340 missense probably damaging 1.00
R0481:9530053A07Rik UTSW 7 28153749 missense probably damaging 1.00
R0497:9530053A07Rik UTSW 7 28147465 missense probably damaging 1.00
R0556:9530053A07Rik UTSW 7 28159378 missense probably benign
R0562:9530053A07Rik UTSW 7 28162690 missense probably benign 0.30
R0586:9530053A07Rik UTSW 7 28137091 missense probably damaging 0.99
R0924:9530053A07Rik UTSW 7 28140130 missense probably damaging 1.00
R0930:9530053A07Rik UTSW 7 28140130 missense probably damaging 1.00
R1103:9530053A07Rik UTSW 7 28154520 missense probably damaging 1.00
R1213:9530053A07Rik UTSW 7 28157673 missense probably damaging 1.00
R1292:9530053A07Rik UTSW 7 28142794 splice site probably benign
R1368:9530053A07Rik UTSW 7 28159478 missense possibly damaging 0.89
R1451:9530053A07Rik UTSW 7 28137157 missense probably damaging 1.00
R1477:9530053A07Rik UTSW 7 28157093 missense probably benign 0.01
R1538:9530053A07Rik UTSW 7 28155492 missense probably damaging 1.00
R1697:9530053A07Rik UTSW 7 28154347 missense probably damaging 1.00
R1741:9530053A07Rik UTSW 7 28157854 missense probably damaging 0.98
R1796:9530053A07Rik UTSW 7 28155372 missense probably damaging 1.00
R1853:9530053A07Rik UTSW 7 28155546 nonsense probably null
R1861:9530053A07Rik UTSW 7 28154732 missense probably damaging 1.00
R1909:9530053A07Rik UTSW 7 28144348 missense possibly damaging 0.52
R1971:9530053A07Rik UTSW 7 28131512 missense possibly damaging 0.90
R1990:9530053A07Rik UTSW 7 28154360 missense probably damaging 0.98
R2020:9530053A07Rik UTSW 7 28155594 missense probably benign
R2084:9530053A07Rik UTSW 7 28157535 missense probably damaging 1.00
R2125:9530053A07Rik UTSW 7 28158022 missense probably benign 0.00
R2132:9530053A07Rik UTSW 7 28155474 missense probably damaging 1.00
R2513:9530053A07Rik UTSW 7 28131635 missense probably damaging 0.99
R2913:9530053A07Rik UTSW 7 28164307 missense probably damaging 1.00
R3150:9530053A07Rik UTSW 7 28154195 missense probably benign 0.21
R3499:9530053A07Rik UTSW 7 28154555 missense probably benign 0.42
R3702:9530053A07Rik UTSW 7 28157778 missense probably damaging 1.00
R3881:9530053A07Rik UTSW 7 28140038 nonsense probably null
R3938:9530053A07Rik UTSW 7 28154294 missense probably damaging 1.00
R4050:9530053A07Rik UTSW 7 28152985 missense possibly damaging 0.55
R4152:9530053A07Rik UTSW 7 28156897 missense possibly damaging 0.47
R4168:9530053A07Rik UTSW 7 28137109 missense probably benign 0.05
R4235:9530053A07Rik UTSW 7 28156648 missense probably damaging 0.99
R4241:9530053A07Rik UTSW 7 28154335 missense probably damaging 1.00
R4363:9530053A07Rik UTSW 7 28146906 missense probably damaging 1.00
R4460:9530053A07Rik UTSW 7 28152856 missense probably benign 0.17
R4463:9530053A07Rik UTSW 7 28150719 missense probably benign
R4841:9530053A07Rik UTSW 7 28150722 missense probably damaging 1.00
R4842:9530053A07Rik UTSW 7 28150722 missense probably damaging 1.00
R4876:9530053A07Rik UTSW 7 28142800 intron probably benign
R4905:9530053A07Rik UTSW 7 28156983 missense possibly damaging 0.93
R4997:9530053A07Rik UTSW 7 28143924 missense possibly damaging 0.77
R5091:9530053A07Rik UTSW 7 28156958 missense probably benign 0.44
R5159:9530053A07Rik UTSW 7 28153308 missense probably benign 0.09
R5326:9530053A07Rik UTSW 7 28155489 missense probably damaging 0.98
R5396:9530053A07Rik UTSW 7 28140183 missense probably benign
R5441:9530053A07Rik UTSW 7 28156914 missense probably damaging 1.00
R5480:9530053A07Rik UTSW 7 28157999 nonsense probably null
R5542:9530053A07Rik UTSW 7 28155489 missense probably damaging 0.98
R5571:9530053A07Rik UTSW 7 28156569 missense probably damaging 0.99
R5613:9530053A07Rik UTSW 7 28142878 intron probably benign
R5637:9530053A07Rik UTSW 7 28152852 missense probably benign 0.00
R5766:9530053A07Rik UTSW 7 28137329 nonsense probably null
R6174:9530053A07Rik UTSW 7 28139959 missense probably damaging 0.96
R6233:9530053A07Rik UTSW 7 28131460 missense probably damaging 0.99
R6250:9530053A07Rik UTSW 7 28150714 missense probably damaging 1.00
R6379:9530053A07Rik UTSW 7 28157592 missense probably damaging 1.00
R6442:9530053A07Rik UTSW 7 28144186 missense possibly damaging 0.88
R6478:9530053A07Rik UTSW 7 28155373 missense probably damaging 1.00
R6699:9530053A07Rik UTSW 7 28144368 missense probably damaging 1.00
R6852:9530053A07Rik UTSW 7 28147135 missense probably damaging 1.00
R6883:9530053A07Rik UTSW 7 28152835 missense possibly damaging 0.89
R6902:9530053A07Rik UTSW 7 28137213 missense probably damaging 1.00
R6903:9530053A07Rik UTSW 7 28137213 missense probably damaging 1.00
R6904:9530053A07Rik UTSW 7 28137213 missense probably damaging 1.00
R6992:9530053A07Rik UTSW 7 28140183 missense probably benign 0.04
R7023:9530053A07Rik UTSW 7 28140038 nonsense probably null
R7039:9530053A07Rik UTSW 7 28140148 missense possibly damaging 0.80
R7171:9530053A07Rik UTSW 7 28154519 nonsense probably null
R7282:9530053A07Rik UTSW 7 28144408 missense probably benign 0.02
R7291:9530053A07Rik UTSW 7 28140220 missense probably benign
R7344:9530053A07Rik UTSW 7 28140279 missense possibly damaging 0.79
R7344:9530053A07Rik UTSW 7 28152760 missense possibly damaging 0.46
R7392:9530053A07Rik UTSW 7 28164372 missense possibly damaging 0.83
R7531:9530053A07Rik UTSW 7 28140231 missense probably benign
R7541:9530053A07Rik UTSW 7 28144256 nonsense probably null
Predicted Primers PCR Primer
(F):5'- ACAGGCAGCCAGTTCCAATGAG -3'
(R):5'- AAGTCAGTGTCACATTCACAGCCC -3'

Sequencing Primer
(F):5'- GAAAAAGCTGTGCCAGGTTCTTC -3'
(R):5'- ATTGCTGAGCAGTCCAGG -3'
Posted On2014-05-09