Mutagenetix > Incidental Mutation

Incidental Mutation 'R1655:Crtc3'

189028

Institutional Source

Beutler Lab

Gene Symbol

Crtc3

Ensembl Gene

ENSMUSG00000030527

Gene Name

CREB regulated transcription coactivator 3

Synonyms

MMRRC Submission

039691-MU

Accession Numbers

Essential gene?

Possibly non essential (E-score: 0.304) question?

Stock #

R1655 (G1)

Quality Score

221

Status

Not validated

Chromosome

Chromosomal Location

80586627-80688877 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 80598776 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Methionine to Lysine at position 313 (M313K)

Ref Sequence

ENSEMBL: ENSMUSP00000113540 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000122255]

AlphaFold

Q91X84

Predicted Effect

possibly damaging
Transcript: ENSMUST00000122255
AA Change: M313K

PolyPhen 2 Score 0.668 (Sensitivity: 0.86; Specificity: 0.91)

SMART Domains

Protein: ENSMUSP00000113540
Gene: ENSMUSG00000030527
AA Change: M313K

Domain	Start	End	E-Value	Type
Pfam:TORC_N	11	82	1.2e-20	PFAM
Pfam:TORC_M	159	321	1.9e-64	PFAM
low complexity region	366	380	N/A	INTRINSIC
low complexity region	438	480	N/A	INTRINSIC
Pfam:TORC_C	545	619	2.2e-30	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000127182

Predicted Effect

probably benign
Transcript: ENSMUST00000127326

Predicted Effect

probably benign
Transcript: ENSMUST00000149176

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000206056

Coding Region Coverage

1x: 99.1%
3x: 98.3%
10x: 96.0%
20x: 91.3%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the CREB regulated transcription coactivator gene family. This family regulates CREB-dependent gene transcription in a phosphorylation-independent manner and may be selective for cAMP-responsive genes. The protein encoded by this gene may induce mitochondrial biogenesis and attenuate catecholamine signaling in adipose tissue. A translocation event between this gene and Notch coactivator mastermind-like gene 2, which results in a fusion protein, has been reported in mucoepidermoid carcinomas. Alternative splicing results in multiple transcript variants that encode different protein isoforms. [provided by RefSeq, Jul 2012]
PHENOTYPE: Mice homozygous for a null mutation display resistance to diet-induced obesity, increased energy expenditure, decreased white adipose tissue mass, increased brown adipose cell numbers, and increased core temperature. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 73 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4833427G06Rik	A	T	9: 51,083,621	I136N	probably damaging	Het
9530053A07Rik	A	T	7: 28,147,110	N1076Y	probably damaging	Het
A730061H03Rik	A	T	14: 55,560,333		probably benign	Het
Abca1	C	T	4: 53,050,964	A1582T	probably benign	Het
Acot8	A	T	2: 164,803,108	S52T	probably benign	Het
Atcay	C	T	10: 81,213,397	V124M	probably damaging	Het
Cep295	C	T	9: 15,340,883	E397K	probably damaging	Het
Cfap46	A	T	7: 139,642,520	Y1180*	probably null	Het
Clptm1	T	A	7: 19,645,867	H148L	probably benign	Het
Clstn3	A	G	6: 124,437,427	L743P	probably damaging	Het
Csgalnact1	T	A	8: 68,373,689	I326F	possibly damaging	Het
Dennd6b	G	T	15: 89,196,340	T19K	unknown	Het
Disp1	A	T	1: 183,087,004	I1284N	probably benign	Het
Dnah2	A	G	11: 69,473,854	Y1992H	probably damaging	Het
Dnah6	C	T	6: 73,205,732	V205I	possibly damaging	Het
Dst	G	T	1: 34,282,576	G4391*	probably null	Het
Dytn	A	G	1: 63,661,198	S258P	probably damaging	Het
Emilin3	T	A	2: 160,910,866		probably null	Het
Ermn	C	T	2: 58,052,584	V45I	probably benign	Het
Fat4	T	C	3: 38,957,318	V2189A	probably damaging	Het
Filip1l	T	C	16: 57,571,851	I934T	probably damaging	Het
Gbp9	T	A	5: 105,081,692	Q472L	possibly damaging	Het
Gimap5	G	T	6: 48,753,176	E227*	probably null	Het
Gsdmc	C	T	15: 63,780,043	V240M	probably benign	Het
H2-Q4	G	T	17: 35,382,905	V248F	probably damaging	Het
Helz2	T	C	2: 181,234,147	E1518G	probably damaging	Het
Hmcn1	A	G	1: 150,630,333	V3814A	probably benign	Het
Ifna7	A	G	4: 88,816,660	T145A	probably benign	Het
Itgam	T	A	7: 128,115,163	M947K	probably benign	Het
Itpr2	T	G	6: 146,376,148	N608H	probably damaging	Het
Klra2	T	A	6: 131,220,211	N242I	probably damaging	Het
Lonrf2	A	T	1: 38,811,824	L219Q	probably damaging	Het
Ly6c2	T	C	15: 75,108,563	I126V	probably benign	Het
Mr1	G	A	1: 155,132,455	T258M	probably benign	Het
Mrps35	T	G	6: 147,060,228	D200E	possibly damaging	Het
Nbeal2	A	C	9: 110,632,872	S1506A	probably damaging	Het
Ncoa7	T	C	10: 30,698,245		probably null	Het
Nlrp4a	A	T	7: 26,449,651	I228F	possibly damaging	Het
Olfr1047	A	G	2: 86,228,080	V297A	possibly damaging	Het
Olfr1339	A	G	4: 118,734,999	S157G	probably benign	Het
Olfr368	A	G	2: 37,331,939	Y64C	probably damaging	Het
Olfr483	A	T	7: 108,103,464	I52F	probably damaging	Het
Paxx	T	C	2: 25,460,316	E93G	probably damaging	Het
Per2	C	A	1: 91,448,768	G128W	probably damaging	Het
Piezo1	A	G	8: 122,496,822	I796T	probably benign	Het
Pkhd1	A	G	1: 20,584,129	S235P	probably damaging	Het
Pole	T	A	5: 110,335,922	F259Y	probably damaging	Het
Pus7	T	A	5: 23,747,800	K512*	probably null	Het
Ralyl	A	T	3: 14,107,236	Y55F	probably damaging	Het
Rgs14	T	A	13: 55,383,534	M451K	probably benign	Het
Rhag	T	C	17: 40,831,596	F231L	probably damaging	Het
Ric8a	T	C	7: 140,860,895	C94R	probably benign	Het
Rictor	T	A	15: 6,772,212	D460E	probably benign	Het
Rpn1	T	C	6: 88,100,944	V454A	possibly damaging	Het
Sacs	A	G	14: 61,191,782	D427G	probably benign	Het
Scai	A	T	2: 39,080,117	V545D	possibly damaging	Het
Serpinb3a	A	G	1: 107,046,212	V323A	probably damaging	Het
Slc13a5	C	A	11: 72,257,378	C277F	probably benign	Het
Slc15a1	A	T	14: 121,465,899	Y557N	probably benign	Het
Slc34a2	T	C	5: 53,069,419	V628A	probably benign	Het
Slc8a2	G	T	7: 16,141,135	G436V	probably damaging	Het
Sphkap	G	A	1: 83,277,515	R838*	probably null	Het
Supt5	T	C	7: 28,330,024	I103V	probably benign	Het
Tdrd1	T	A	19: 56,843,216	Y346*	probably null	Het
Tg	T	G	15: 66,828,568		probably null	Het
Top1	T	A	2: 160,703,696		probably null	Het
Trmt12	T	C	15: 58,873,227	L158P	probably damaging	Het
Tssk4	A	G	14: 55,651,695	N226S	probably damaging	Het
Unc80	G	T	1: 66,672,756	V2746F	possibly damaging	Het
Usp34	T	A	11: 23,375,051	V999E	probably benign	Het
Virma	T	C	4: 11,494,786	V29A	probably damaging	Het
Zfp40	A	T	17: 23,177,266	Y48N	probably benign	Het
Zfp609	A	G	9: 65,703,554	V709A	possibly damaging	Het

Other mutations in Crtc3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01087:Crtc3	APN	7	80598739	intron	probably benign
IGL01325:Crtc3	APN	7	80677368	missense	probably damaging	0.96
IGL01802:Crtc3	APN	7	80604368	nonsense	probably null
IGL02166:Crtc3	APN	7	80677399	missense	probably damaging	1.00
IGL02601:Crtc3	APN	7	80592567	missense	probably damaging	1.00
IGL02719:Crtc3	APN	7	80618658	critical splice acceptor site	probably null
IGL02936:Crtc3	APN	7	80589763	missense	probably damaging	1.00
IGL03075:Crtc3	APN	7	80604403	intron	probably benign
R0856:Crtc3	UTSW	7	80595624	missense	probably damaging	0.99
R1962:Crtc3	UTSW	7	80589931	missense	probably damaging	1.00
R4484:Crtc3	UTSW	7	80589948	missense	probably damaging	1.00
R4533:Crtc3	UTSW	7	80589795	missense	probably damaging	0.97
R4818:Crtc3	UTSW	7	80677422	missense	possibly damaging	0.65
R5292:Crtc3	UTSW	7	80618610	missense	possibly damaging	0.94
R5908:Crtc3	UTSW	7	80595794	missense	possibly damaging	0.54
R8991:Crtc3	UTSW	7	80677443	missense	probably damaging	0.96
R9092:Crtc3	UTSW	7	80589880	missense	probably benign
R9121:Crtc3	UTSW	7	80592575	missense	probably damaging	1.00
R9170:Crtc3	UTSW	7	80598949	missense	probably damaging	0.99
R9321:Crtc3	UTSW	7	80609902	missense	probably benign	0.04

Predicted Primers

PCR Primer
(F):5'- TCCCCAAGTTCTCTGCACACATGG -3'
(R):5'- GGTAAGCTGACAGACTGCGTTCTC -3'

Sequencing Primer
(F):5'- GCTCGTGACGACAGTGAAG -3'
(R):5'- TGGGTCTCAGTCATCAGCAAG -3'

Posted On

2014-05-09