Incidental Mutation 'R1746:Plxnc1'
ID193996
Institutional Source Beutler Lab
Gene Symbol Plxnc1
Ensembl Gene ENSMUSG00000074785
Gene Nameplexin C1
SynonymsCD232, vespr, 2510048K12Rik
MMRRC Submission 039778-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.560) question?
Stock #R1746 (G1)
Quality Score225
Status Validated
Chromosome10
Chromosomal Location94790866-94944835 bp(-) (GRCm38)
Type of Mutationsplice site (3 bp from exon)
DNA Base Change (assembly) T to C at 94844179 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000096939 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099337]
Predicted Effect probably null
Transcript: ENSMUST00000099337
SMART Domains Protein: ENSMUSP00000096939
Gene: ENSMUSG00000074785

DomainStartEndE-ValueType
signal peptide 1 34 N/A INTRINSIC
Pfam:Sema 87 431 5.5e-10 PFAM
PSI 454 507 5.28e-12 SMART
PSI 590 634 1.07e-3 SMART
Pfam:TIG 665 752 3.7e-9 PFAM
IPT 755 847 5.14e-7 SMART
IPT 849 954 1.8e-2 SMART
low complexity region 978 997 N/A INTRINSIC
Pfam:Plexin_cytopl 1018 1541 1.4e-199 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000180514
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 97.4%
  • 3x: 96.9%
  • 10x: 95.3%
  • 20x: 92.6%
Validation Efficiency 100% (62/62)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the plexin family. Plexins are transmembrane receptors for semaphorins, a large family of proteins that regulate axon guidance, cell motility and migration, and the immune response. The encoded protein and its ligand regulate melanocyte adhesion, and viral semaphorins may modulate the immune response by binding to this receptor. The encoded protein may be a tumor suppressor protein for melanoma. Alternatively spliced transcript variants have been observed for this gene. [provided by RefSeq, Jan 2011]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit abnormal neuron morphology and migration. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts16 T A 13: 70,779,598 probably null Het
Agrp G T 8: 105,566,835 T106K probably damaging Het
Aknad1 A G 3: 108,751,783 T38A possibly damaging Het
Anpep C T 7: 79,838,256 E518K probably benign Het
Arhgap21 T C 2: 20,861,099 E902G probably damaging Het
Atg2b A G 12: 105,669,329 S227P possibly damaging Het
Atp2c2 C T 8: 119,734,443 probably benign Het
Atxn10 T C 15: 85,376,663 V203A probably damaging Het
Chd9 A C 8: 91,010,698 E1468D probably benign Het
Cntn5 T A 9: 9,831,572 D601V probably damaging Het
Col4a2 G A 8: 11,446,020 G1547D probably benign Het
Cul1 A G 6: 47,508,245 E270G probably damaging Het
Dclk2 C T 3: 86,805,639 R503Q possibly damaging Het
Dmgdh C A 13: 93,752,425 T857K probably benign Het
Ednra T G 8: 77,671,582 T279P probably benign Het
Erbin A G 13: 103,850,831 I407T probably damaging Het
Fggy A G 4: 95,926,728 Y440C probably damaging Het
Flrt2 A T 12: 95,780,792 N635Y possibly damaging Het
Fnbp1l A G 3: 122,556,491 I357T probably benign Het
Gulp1 A G 1: 44,754,353 H58R possibly damaging Het
Hid1 A T 11: 115,354,638 V446E probably damaging Het
Igfn1 A G 1: 135,969,823 S1002P possibly damaging Het
Klri1 A G 6: 129,698,155 probably null Het
Kmt2d A C 15: 98,864,378 L409R probably damaging Het
Ltn1 A C 16: 87,411,781 S810A possibly damaging Het
Mysm1 G A 4: 94,948,411 Q721* probably null Het
Nae1 A G 8: 104,527,385 V105A possibly damaging Het
Nagpa C T 16: 5,203,639 V83M probably damaging Het
Nrg2 G A 18: 36,021,922 T503M probably damaging Het
Nrxn3 A G 12: 89,255,019 M150V possibly damaging Het
Olfr472 C A 7: 107,902,886 H56Q probably benign Het
Olfr945 A G 9: 39,258,202 S157P probably damaging Het
Papola T A 12: 105,807,209 D162E probably benign Het
Ppp1r16b T A 2: 158,746,665 probably null Het
Ptprq T A 10: 107,638,830 E1338V probably damaging Het
Puf60 G A 15: 76,070,784 H437Y probably benign Het
Qsox2 C T 2: 26,220,638 V189I probably benign Het
Rad51ap2 A T 12: 11,457,775 D566V probably benign Het
Rb1cc1 T A 1: 6,263,013 probably null Het
Rfpl4b C T 10: 38,821,053 C184Y possibly damaging Het
Rif1 GCCACCA GCCA 2: 52,110,324 probably benign Het
Rundc3a GAGCC GAGCCAGCC 11: 102,400,913 probably null Het
Scara5 A C 14: 65,731,090 M271L probably benign Het
Sel1l2 A G 2: 140,285,237 L118P probably damaging Het
Sema6a T A 18: 47,306,349 probably benign Het
Siglech T A 7: 55,768,504 H73Q probably benign Het
Sim1 A G 10: 50,984,109 D689G probably benign Het
Skp2 T C 15: 9,139,443 E55G possibly damaging Het
Slc1a1 T A 19: 28,894,469 V114E probably benign Het
Slc26a6 G A 9: 108,861,717 G614D probably benign Het
Sptbn2 C T 19: 4,745,964 Q1724* probably null Het
Tet3 T C 6: 83,368,068 T1796A probably damaging Het
Tmem117 A C 15: 94,931,833 D183A possibly damaging Het
Trmt44 A G 5: 35,564,059 S587P probably benign Het
Ttn G T 2: 76,788,822 probably benign Het
Tubgcp5 G A 7: 55,808,537 V399M probably benign Het
Txndc2 T A 17: 65,638,135 D349V probably damaging Het
Uggt2 T A 14: 119,013,503 N1194I probably benign Het
Vmn1r178 A T 7: 23,893,904 I53L probably benign Het
Vmn2r-ps159 G T 4: 156,334,397 noncoding transcript Het
Other mutations in Plxnc1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00843:Plxnc1 APN 10 94847549 missense probably benign 0.25
IGL01285:Plxnc1 APN 10 94799368 missense probably damaging 0.99
IGL01867:Plxnc1 APN 10 94798146 missense possibly damaging 0.61
IGL01994:Plxnc1 APN 10 94849939 missense probably damaging 1.00
IGL02083:Plxnc1 APN 10 94922725 missense possibly damaging 0.61
IGL02250:Plxnc1 APN 10 94871031 missense probably benign 0.00
IGL02429:Plxnc1 APN 10 94882591 missense probably benign 0.00
IGL02752:Plxnc1 APN 10 94794680 unclassified probably null
IGL02973:Plxnc1 APN 10 94810684 missense probably damaging 1.00
R0230:Plxnc1 UTSW 10 94799347 missense probably benign 0.07
R0265:Plxnc1 UTSW 10 94813129 missense probably benign 0.14
R0271:Plxnc1 UTSW 10 94837918 missense probably null 1.00
R0299:Plxnc1 UTSW 10 94849821 critical splice donor site probably null
R0361:Plxnc1 UTSW 10 94865007 missense probably damaging 1.00
R0441:Plxnc1 UTSW 10 94796482 missense probably damaging 1.00
R0558:Plxnc1 UTSW 10 94837935 missense probably damaging 1.00
R0617:Plxnc1 UTSW 10 94799368 missense probably damaging 1.00
R0671:Plxnc1 UTSW 10 94799332 missense possibly damaging 0.63
R0692:Plxnc1 UTSW 10 94837500 critical splice donor site probably null
R0751:Plxnc1 UTSW 10 94831333 splice site probably benign
R1184:Plxnc1 UTSW 10 94831333 splice site probably benign
R1260:Plxnc1 UTSW 10 94831365 missense probably damaging 0.99
R1680:Plxnc1 UTSW 10 94841551 missense probably benign 0.14
R1750:Plxnc1 UTSW 10 94799497 missense probably damaging 1.00
R1751:Plxnc1 UTSW 10 94849815 unclassified probably benign
R1768:Plxnc1 UTSW 10 94844322 missense probably benign 0.05
R1876:Plxnc1 UTSW 10 94866941 missense possibly damaging 0.94
R2004:Plxnc1 UTSW 10 94852622 missense probably damaging 0.98
R2031:Plxnc1 UTSW 10 94943667 missense probably benign 0.26
R2184:Plxnc1 UTSW 10 94944269 missense probably damaging 1.00
R2437:Plxnc1 UTSW 10 94906533 missense probably benign 0.02
R2927:Plxnc1 UTSW 10 94793292 critical splice acceptor site probably null
R3001:Plxnc1 UTSW 10 94793218 missense probably damaging 0.98
R3002:Plxnc1 UTSW 10 94793218 missense probably damaging 0.98
R3003:Plxnc1 UTSW 10 94793218 missense probably damaging 0.98
R3441:Plxnc1 UTSW 10 94871010 missense probably benign 0.00
R3849:Plxnc1 UTSW 10 94794432 missense probably benign 0.01
R3884:Plxnc1 UTSW 10 94910687 intron probably null
R4004:Plxnc1 UTSW 10 94794597 nonsense probably null
R4679:Plxnc1 UTSW 10 94794444 missense probably damaging 1.00
R4730:Plxnc1 UTSW 10 94867468 intron probably benign
R4937:Plxnc1 UTSW 10 94841473 missense probably damaging 1.00
R5068:Plxnc1 UTSW 10 94799377 missense possibly damaging 0.91
R5345:Plxnc1 UTSW 10 94849969 missense probably benign 0.26
R5397:Plxnc1 UTSW 10 94843752 missense probably benign 0.08
R5416:Plxnc1 UTSW 10 94837554 missense probably damaging 1.00
R5485:Plxnc1 UTSW 10 94922742 missense probably benign 0.00
R5543:Plxnc1 UTSW 10 94864774 missense probably benign
R5826:Plxnc1 UTSW 10 94799473 critical splice donor site probably null
R6007:Plxnc1 UTSW 10 94793290 missense possibly damaging 0.88
R6018:Plxnc1 UTSW 10 94943848 missense probably benign 0.21
R6052:Plxnc1 UTSW 10 94943773 missense probably benign 0.13
R6291:Plxnc1 UTSW 10 94833642 splice site probably null
R6653:Plxnc1 UTSW 10 94943876 missense probably damaging 1.00
R6984:Plxnc1 UTSW 10 94831530 missense probably damaging 1.00
R7086:Plxnc1 UTSW 10 94831435 missense probably benign
R7401:Plxnc1 UTSW 10 94871005 missense probably benign
R7727:Plxnc1 UTSW 10 94944109 missense probably damaging 1.00
R7789:Plxnc1 UTSW 10 94794477 missense probably damaging 1.00
R7803:Plxnc1 UTSW 10 94943515 critical splice donor site probably null
R7809:Plxnc1 UTSW 10 94794440 missense probably damaging 1.00
R7882:Plxnc1 UTSW 10 94843836 missense probably benign
R7965:Plxnc1 UTSW 10 94843836 missense probably benign
RF003:Plxnc1 UTSW 10 94794444 missense probably damaging 1.00
RF045:Plxnc1 UTSW 10 94865007 missense probably damaging 1.00
RF046:Plxnc1 UTSW 10 94865007 missense probably damaging 1.00
RF047:Plxnc1 UTSW 10 94865007 missense probably damaging 1.00
X0024:Plxnc1 UTSW 10 94864715 critical splice donor site probably null
Z1176:Plxnc1 UTSW 10 94865029 missense probably benign 0.16
Predicted Primers PCR Primer
(F):5'- TCTCCAGACCAGGGATAAGAACAGC -3'
(R):5'- TGTGCAGAATACTTCCTGTGTGCC -3'

Sequencing Primer
(F):5'- gaagaaaggaaggaaggaaggg -3'
(R):5'- CCAGGTCTCTGAATACTGCG -3'
Posted On2014-05-23