Mutagenetix > Incidental Mutations

Incidental Mutation 'R1769:Gata2'

194687

Institutional Source

Beutler Lab

Gene Symbol

Gata2

Ensembl Gene

ENSMUSG00000015053

Gene Name

GATA binding protein 2

Synonyms

Gata-2

MMRRC Submission

039800-MU

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R1769 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

88193891-88207032 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 88205255 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Serine to Glycine at position 402 (S402G)

Ref Sequence

ENSEMBL: ENSMUSP00000128198 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000015197] [ENSMUST00000170089]

AlphaFold

O09100

Predicted Effect

probably benign
Transcript: ENSMUST00000015197
AA Change: S402G

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000015197
Gene: ENSMUSG00000015053
AA Change: S402G

Domain	Start	End	E-Value	Type
low complexity region	103	114	N/A	INTRINSIC
low complexity region	143	158	N/A	INTRINSIC
low complexity region	182	201	N/A	INTRINSIC
ZnF_GATA	289	339	2.37e-19	SMART
ZnF_GATA	343	393	1.26e-23	SMART
low complexity region	399	409	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000170089
AA Change: S402G

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000128198
Gene: ENSMUSG00000015053
AA Change: S402G

Domain	Start	End	E-Value	Type
low complexity region	103	114	N/A	INTRINSIC
low complexity region	143	158	N/A	INTRINSIC
low complexity region	182	201	N/A	INTRINSIC
ZnF_GATA	289	339	2.37e-19	SMART
ZnF_GATA	343	393	1.26e-23	SMART
low complexity region	399	409	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000203579

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000205151

Meta Mutation Damage Score

0.0898

Coding Region Coverage

1x: 97.5%
3x: 96.9%
10x: 95.3%
20x: 92.5%

Validation Efficiency

100% (91/91)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the GATA family of zinc-finger transcription factors that are named for the consensus nucleotide sequence they bind in the promoter regions of target genes. The encoded protein plays an essential role in regulating transcription of genes involved in the development and proliferation of hematopoietic and endocrine cell lineages. Alternative splicing results in multiple transcript variants.[provided by RefSeq, Mar 2009]
PHENOTYPE: Homozygous mutant show reduced placental secretion of angiogenic factors, hematopoietic defects, enlarged pericardial sacs, reduced numbers of V2-expressing interneurons of ventral spinal cord, and die by embryonic day 11.5. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 91 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4921507P07Rik	A	G	6: 50,591,821		probably benign	Het
A430033K04Rik	A	G	5: 138,646,257	I135V	probably benign	Het
Abca1	T	A	4: 53,074,325	K1119N	probably damaging	Het
Abcb10	C	T	8: 123,962,052	G495D	probably damaging	Het
Abcc9	T	C	6: 142,627,468		probably benign	Het
Akap3	A	G	6: 126,865,846	E476G	possibly damaging	Het
Aldh3b1	A	G	19: 3,918,740	F271S	probably damaging	Het
Alkbh2	C	T	5: 114,124,226	E148K	probably damaging	Het
Ascc3	T	C	10: 50,700,490	V847A	probably damaging	Het
Best3	A	G	10: 117,023,978	N381S	probably benign	Het
Blm	A	T	7: 80,513,370	S78T	probably benign	Het
Bmpr2	T	A	1: 59,868,361	L871Q	probably damaging	Het
Car13	T	A	3: 14,650,735	H104Q	probably benign	Het
Ccdc39	T	C	3: 33,826,480	K446R	probably damaging	Het
Ccnb1ip1	T	C	14: 50,792,111	M165V	probably benign	Het
Cd4	A	T	6: 124,866,655	M431K	possibly damaging	Het
Cdh7	C	T	1: 110,052,876	T178I	probably damaging	Het
Ceacam3	C	T	7: 17,158,376	T348I	probably damaging	Het
Cfap54	C	T	10: 92,904,263		probably null	Het
Clcn6	A	T	4: 148,014,301		probably null	Het
Csf3	A	G	11: 98,702,420	Y121C	probably damaging	Het
Csmd3	C	T	15: 47,704,109		probably benign	Het
Cyp2c69	A	G	19: 39,876,371	I221T	probably benign	Het
Dgcr2	T	C	16: 17,857,251		probably benign	Het
Dhcr7	T	C	7: 143,847,513	F474S	probably damaging	Het
Dnah1	T	C	14: 31,310,882	I399V	probably null	Het
Efcab14	T	A	4: 115,752,991	L183Q	probably damaging	Het
Elmsan1	G	A	12: 84,158,350		probably benign	Het
Evx2	A	G	2: 74,659,157	V88A	probably benign	Het
Exph5	A	G	9: 53,373,809	N730S	probably benign	Het
Farsb	T	A	1: 78,466,983	K196I	probably benign	Het
Fbln7	C	T	2: 128,893,762		probably benign	Het
Fhdc1	A	G	3: 84,448,778	F453S	probably damaging	Het
Gast	T	A	11: 100,336,858	W89R	probably damaging	Het
Gin1	T	A	1: 97,792,437	S386T	probably benign	Het
Golgb1	A	G	16: 36,916,001	E1870G	probably damaging	Het
Hivep3	T	A	4: 120,097,571	V1028E	possibly damaging	Het
Ifi203	G	A	1: 173,928,760	R486*	probably null	Het
Ifi209	G	A	1: 173,641,162	S186N	probably benign	Het
Ifih1	C	T	2: 62,606,394	A562T	probably damaging	Het
Itch	T	C	2: 155,172,561	L106S	probably damaging	Het
Itga4	T	A	2: 79,315,706		probably null	Het
Kdm4c	A	G	4: 74,280,997	S141G	possibly damaging	Het
Kirrel	C	T	3: 87,089,151	M380I	probably null	Het
Klra3	T	C	6: 130,330,263		probably null	Het
Lama2	A	T	10: 27,208,406	S923T	probably damaging	Het
Lama2	G	C	10: 27,208,407	F922L	probably benign	Het
Llgl1	G	A	11: 60,707,047	V331M	probably damaging	Het
Lrrc30	T	C	17: 67,631,681	*301W	probably null	Het
Map1lc3b	C	T	8: 121,593,487		probably benign	Het
Mbd2	A	G	18: 70,616,619	I302V	probably benign	Het
Med27	A	G	2: 29,500,295	Y78C	probably damaging	Het
Mei1	C	T	15: 82,112,570		probably null	Het
Miga1	T	C	3: 152,287,554	E346G	probably damaging	Het
Myef2	A	G	2: 125,115,443	S131P	probably damaging	Het
Myocd	T	C	11: 65,178,701	H899R	probably benign	Het
Ncam1	A	G	9: 49,545,256		probably benign	Het
Ngf	T	A	3: 102,520,197	N87K	possibly damaging	Het
Nol10	T	A	12: 17,416,708		probably benign	Het
Nrip2	A	G	6: 128,408,268	I221V	probably benign	Het
Nup205	G	A	6: 35,205,431	G777D	probably damaging	Het
Olfr1446	A	G	19: 12,889,683	V298A	probably damaging	Het
Olfr199	A	G	16: 59,215,981	F211L	probably benign	Het
Olfr802	T	A	10: 129,682,212	T176S	probably benign	Het
Olfr855	A	T	9: 19,585,386	Q283L	probably damaging	Het
Olfr974	G	T	9: 39,942,955	D232Y	probably benign	Het
Oxt	A	T	2: 130,576,300	R31W	probably damaging	Het
Pde4dip	A	G	3: 97,695,930	S2248P	probably benign	Het
Pias1	A	G	9: 62,952,178	V16A	probably damaging	Het
Pkp2	T	C	16: 16,262,697	S616P	probably damaging	Het
Plch2	T	C	4: 155,000,083	Y379C	probably damaging	Het
Pnpt1	A	G	11: 29,154,159	N540D	probably benign	Het
Ptpn23	G	A	9: 110,391,678	H255Y	possibly damaging	Het
Rad21	T	C	15: 51,972,307	N237D	probably benign	Het
Ryr3	A	C	2: 112,751,768		probably null	Het
Sgk1	C	A	10: 21,997,108		probably benign	Het
Slc1a5	G	T	7: 16,797,539	A490S	probably damaging	Het
Slc5a8	T	C	10: 88,919,464	Y478H	probably benign	Het
Slc5a8	T	A	10: 88,919,466	Y478*	probably null	Het
Slc9a3	A	T	13: 74,163,071	M562L	probably benign	Het
Thsd7a	G	A	6: 12,555,715	R57*	probably null	Het
Tiam1	T	C	16: 89,860,279	R690G	probably damaging	Het
Tmem150b	A	G	7: 4,724,366	S47P	probably damaging	Het
Trim39	C	T	17: 36,263,940	R190Q	probably damaging	Het
Ttc32	A	T	12: 9,035,073	I98L	possibly damaging	Het
Vps13c	A	G	9: 67,965,721	T3304A	probably benign	Het
Wdr35	A	C	12: 9,012,728	D638A	probably damaging	Het
Wwc1	G	T	11: 35,861,844	P797T	probably benign	Het
Zan	T	A	5: 137,464,518	T800S	unknown	Het
Zbbx	A	G	3: 75,083,619		probably benign	Het
Zufsp	T	C	10: 33,935,176	M291V	probably damaging	Het

Other mutations in Gata2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL02558:Gata2	APN	6	88199780	missense	probably benign	0.04
IGL02616:Gata2	APN	6	88205480	missense	possibly damaging	0.88
IGL02637:Gata2	APN	6	88204576	unclassified	probably benign
IGL02705:Gata2	APN	6	88205364	missense	possibly damaging	0.49
IGL03143:Gata2	APN	6	88204695	missense	probably damaging	1.00
R1222:Gata2	UTSW	6	88200341	missense	probably benign	0.31
R3921:Gata2	UTSW	6	88205482	makesense	probably null
R4151:Gata2	UTSW	6	88199638	missense	probably damaging	1.00
R5834:Gata2	UTSW	6	88200747	missense	probably benign	0.04
R5875:Gata2	UTSW	6	88202491	missense	probably damaging	1.00
R5888:Gata2	UTSW	6	88200740	missense	probably benign	0.00
R6236:Gata2	UTSW	6	88202566	critical splice donor site	probably null
R7605:Gata2	UTSW	6	88200408	missense	possibly damaging	0.89
R8752:Gata2	UTSW	6	88200531	missense	possibly damaging	0.90
X0026:Gata2	UTSW	6	88204612	nonsense	probably null

Predicted Primers

PCR Primer
(F):5'- ATTAACTCAGCCTGCCTCGACCTG -3'
(R):5'- TGCCAAACCACCCTTGATGTCC -3'

Sequencing Primer
(F):5'- CCTCGACCTGTGGAGAGAG -3'
(R):5'- ATGGCAGTCACCATGCTGG -3'

Posted On

2014-05-23