Incidental Mutation 'R1769:Lama2'
ID 194709
Institutional Source Beutler Lab
Gene Symbol Lama2
Ensembl Gene ENSMUSG00000019899
Gene Name laminin, alpha 2
Synonyms merosin, mer
MMRRC Submission 039800-MU
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.398) question?
Stock # R1769 (G1)
Quality Score 225
Status Validated
Chromosome 10
Chromosomal Location 26980036-27619758 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) G to C at 27208407 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Phenylalanine to Leucine at position 922 (F922L)
Ref Sequence ENSEMBL: ENSMUSP00000140716 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000092639] [ENSMUST00000189575]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000092639
AA Change: F922L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000090304
Gene: ENSMUSG00000019899
AA Change: F922L

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
LamNT 29 281 5.35e-129 SMART
EGF_Lam 283 337 2.11e-4 SMART
EGF_Lam 340 407 1.59e-8 SMART
EGF_Lam 410 462 5.44e-7 SMART
EGF_Lam 465 511 9.05e-4 SMART
LamB 574 706 2.26e-44 SMART
Pfam:Laminin_EGF 715 745 2.8e-4 PFAM
EGF_Lam 753 800 4.03e-10 SMART
EGF_Lam 803 858 3.01e-9 SMART
EGF_Lam 861 911 1.35e-11 SMART
EGF_Lam 914 960 7.23e-12 SMART
EGF_Lam 963 1007 5.87e-12 SMART
EGF_Lam 1010 1053 1.28e-12 SMART
EGF_Lam 1056 1099 2.37e-7 SMART
EGF_Lam 1102 1159 3.22e-9 SMART
LamB 1225 1360 1.95e-57 SMART
EGF_like 1364 1413 8.13e-1 SMART
EGF_Lam 1416 1462 5.48e-12 SMART
EGF_Lam 1465 1520 1.27e-7 SMART
EGF_Lam 1523 1567 2.4e-8 SMART
Pfam:Laminin_I 1584 1849 2e-92 PFAM
Blast:MA 1881 2113 1e-112 BLAST
LamG 2162 2307 1.28e-25 SMART
LamG 2356 2500 2.2e-33 SMART
LamG 2542 2688 3.31e-28 SMART
low complexity region 2725 2741 N/A INTRINSIC
LamG 2781 2914 2.25e-39 SMART
LamG 2956 3092 1.53e-32 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000189575
AA Change: F922L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000140716
Gene: ENSMUSG00000019899
AA Change: F922L

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
LamNT 29 281 2.5e-131 SMART
EGF_Lam 283 337 1e-6 SMART
EGF_Lam 340 407 7.7e-11 SMART
EGF_Lam 410 462 2.6e-9 SMART
EGF_Lam 465 511 4.5e-6 SMART
LamB 574 706 1.4e-46 SMART
Pfam:Laminin_EGF 715 745 1.7e-2 PFAM
EGF_Lam 753 800 1.9e-12 SMART
EGF_Lam 803 858 1.4e-11 SMART
EGF_Lam 861 911 6.7e-14 SMART
EGF_Lam 914 960 3.6e-14 SMART
EGF_Lam 963 1007 2.9e-14 SMART
EGF_Lam 1010 1053 6.1e-15 SMART
EGF_Lam 1056 1099 1.1e-9 SMART
EGF_Lam 1102 1159 1.5e-11 SMART
LamB 1225 1349 1.4e-45 SMART
Meta Mutation Damage Score 0.0696 question?
Coding Region Coverage
  • 1x: 97.5%
  • 3x: 96.9%
  • 10x: 95.3%
  • 20x: 92.5%
Validation Efficiency 100% (91/91)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Laminin, an extracellular protein, is a major component of the basement membrane. It is thought to mediate the attachment, migration, and organization of cells into tissues during embryonic development by interacting with other extracellular matrix components. It is composed of three subunits, alpha, beta, and gamma, which are bound to each other by disulfide bonds into a cross-shaped molecule. This gene encodes the alpha 2 chain, which constitutes one of the subunits of laminin 2 (merosin) and laminin 4 (s-merosin). Mutations in this gene have been identified as the cause of congenital merosin-deficient muscular dystrophy. Two transcript variants encoding different proteins have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for targeted and spontaneous mutations exhibit progressive growth retardation, ataxia, muscle atrophy and degeneration, infertility, and premature lethality. Muscle fiber degeneration is evident as early as the first week of life. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 90 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921507P07Rik A G 6: 50,591,821 (GRCm38) probably benign Het
A430033K04Rik A G 5: 138,646,257 (GRCm38) I135V probably benign Het
Abca1 T A 4: 53,074,325 (GRCm38) K1119N probably damaging Het
Abcb10 C T 8: 123,962,052 (GRCm38) G495D probably damaging Het
Abcc9 T C 6: 142,627,468 (GRCm38) probably benign Het
Akap3 A G 6: 126,865,846 (GRCm38) E476G possibly damaging Het
Aldh3b1 A G 19: 3,918,740 (GRCm38) F271S probably damaging Het
Alkbh2 C T 5: 114,124,226 (GRCm38) E148K probably damaging Het
Ascc3 T C 10: 50,700,490 (GRCm38) V847A probably damaging Het
Best3 A G 10: 117,023,978 (GRCm38) N381S probably benign Het
Blm A T 7: 80,513,370 (GRCm38) S78T probably benign Het
Bmpr2 T A 1: 59,868,361 (GRCm38) L871Q probably damaging Het
Car13 T A 3: 14,650,735 (GRCm38) H104Q probably benign Het
Ccdc39 T C 3: 33,826,480 (GRCm38) K446R probably damaging Het
Ccnb1ip1 T C 14: 50,792,111 (GRCm38) M165V probably benign Het
Cd4 A T 6: 124,866,655 (GRCm38) M431K possibly damaging Het
Cdh7 C T 1: 110,052,876 (GRCm38) T178I probably damaging Het
Ceacam3 C T 7: 17,158,376 (GRCm38) T348I probably damaging Het
Cfap54 C T 10: 92,904,263 (GRCm38) probably null Het
Clcn6 A T 4: 148,014,301 (GRCm38) probably null Het
Csf3 A G 11: 98,702,420 (GRCm38) Y121C probably damaging Het
Csmd3 C T 15: 47,704,109 (GRCm38) probably benign Het
Cyp2c69 A G 19: 39,876,371 (GRCm38) I221T probably benign Het
Dgcr2 T C 16: 17,857,251 (GRCm38) probably benign Het
Dhcr7 T C 7: 143,847,513 (GRCm38) F474S probably damaging Het
Dnah1 T C 14: 31,310,882 (GRCm38) I399V probably null Het
Efcab14 T A 4: 115,752,991 (GRCm38) L183Q probably damaging Het
Elmsan1 G A 12: 84,158,350 (GRCm38) probably benign Het
Evx2 A G 2: 74,659,157 (GRCm38) V88A probably benign Het
Exph5 A G 9: 53,373,809 (GRCm38) N730S probably benign Het
Farsb T A 1: 78,466,983 (GRCm38) K196I probably benign Het
Fbln7 C T 2: 128,893,762 (GRCm38) probably benign Het
Fhdc1 A G 3: 84,448,778 (GRCm38) F453S probably damaging Het
Gast T A 11: 100,336,858 (GRCm38) W89R probably damaging Het
Gata2 A G 6: 88,205,255 (GRCm38) S402G probably benign Het
Gin1 T A 1: 97,792,437 (GRCm38) S386T probably benign Het
Golgb1 A G 16: 36,916,001 (GRCm38) E1870G probably damaging Het
Hivep3 T A 4: 120,097,571 (GRCm38) V1028E possibly damaging Het
Ifi203 G A 1: 173,928,760 (GRCm38) R486* probably null Het
Ifi209 G A 1: 173,641,162 (GRCm38) S186N probably benign Het
Ifih1 C T 2: 62,606,394 (GRCm38) A562T probably damaging Het
Itch T C 2: 155,172,561 (GRCm38) L106S probably damaging Het
Itga4 T A 2: 79,315,706 (GRCm38) probably null Het
Kdm4c A G 4: 74,280,997 (GRCm38) S141G possibly damaging Het
Kirrel C T 3: 87,089,151 (GRCm38) M380I probably null Het
Klra3 T C 6: 130,330,263 (GRCm38) probably null Het
Llgl1 G A 11: 60,707,047 (GRCm38) V331M probably damaging Het
Lrrc30 T C 17: 67,631,681 (GRCm38) *301W probably null Het
Map1lc3b C T 8: 121,593,487 (GRCm38) probably benign Het
Mbd2 A G 18: 70,616,619 (GRCm38) I302V probably benign Het
Med27 A G 2: 29,500,295 (GRCm38) Y78C probably damaging Het
Mei1 C T 15: 82,112,570 (GRCm38) probably null Het
Miga1 T C 3: 152,287,554 (GRCm38) E346G probably damaging Het
Myef2 A G 2: 125,115,443 (GRCm38) S131P probably damaging Het
Myocd T C 11: 65,178,701 (GRCm38) H899R probably benign Het
Ncam1 A G 9: 49,545,256 (GRCm38) probably benign Het
Ngf T A 3: 102,520,197 (GRCm38) N87K possibly damaging Het
Nol10 T A 12: 17,416,708 (GRCm38) probably benign Het
Nrip2 A G 6: 128,408,268 (GRCm38) I221V probably benign Het
Nup205 G A 6: 35,205,431 (GRCm38) G777D probably damaging Het
Olfr1446 A G 19: 12,889,683 (GRCm38) V298A probably damaging Het
Olfr199 A G 16: 59,215,981 (GRCm38) F211L probably benign Het
Olfr802 T A 10: 129,682,212 (GRCm38) T176S probably benign Het
Olfr855 A T 9: 19,585,386 (GRCm38) Q283L probably damaging Het
Olfr974 G T 9: 39,942,955 (GRCm38) D232Y probably benign Het
Oxt A T 2: 130,576,300 (GRCm38) R31W probably damaging Het
Pde4dip A G 3: 97,695,930 (GRCm38) S2248P probably benign Het
Pias1 A G 9: 62,952,178 (GRCm38) V16A probably damaging Het
Pkp2 T C 16: 16,262,697 (GRCm38) S616P probably damaging Het
Plch2 T C 4: 155,000,083 (GRCm38) Y379C probably damaging Het
Pnpt1 A G 11: 29,154,159 (GRCm38) N540D probably benign Het
Ptpn23 G A 9: 110,391,678 (GRCm38) H255Y possibly damaging Het
Rad21 T C 15: 51,972,307 (GRCm38) N237D probably benign Het
Ryr3 A C 2: 112,751,768 (GRCm38) probably null Het
Sgk1 C A 10: 21,997,108 (GRCm38) probably benign Het
Slc1a5 G T 7: 16,797,539 (GRCm38) A490S probably damaging Het
Slc5a8 T A 10: 88,919,466 (GRCm38) Y478* probably null Het
Slc5a8 T C 10: 88,919,464 (GRCm38) Y478H probably benign Het
Slc9a3 A T 13: 74,163,071 (GRCm38) M562L probably benign Het
Thsd7a G A 6: 12,555,715 (GRCm38) R57* probably null Het
Tiam1 T C 16: 89,860,279 (GRCm38) R690G probably damaging Het
Tmem150b A G 7: 4,724,366 (GRCm38) S47P probably damaging Het
Trim39 C T 17: 36,263,940 (GRCm38) R190Q probably damaging Het
Ttc32 A T 12: 9,035,073 (GRCm38) I98L possibly damaging Het
Vps13c A G 9: 67,965,721 (GRCm38) T3304A probably benign Het
Wdr35 A C 12: 9,012,728 (GRCm38) D638A probably damaging Het
Wwc1 G T 11: 35,861,844 (GRCm38) P797T probably benign Het
Zan T A 5: 137,464,518 (GRCm38) T800S unknown Het
Zbbx A G 3: 75,083,619 (GRCm38) probably benign Het
Zufsp T C 10: 33,935,176 (GRCm38) M291V probably damaging Het
Other mutations in Lama2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00392:Lama2 APN 10 27,188,265 (GRCm38) missense probably benign 0.01
IGL00467:Lama2 APN 10 27,467,197 (GRCm38) splice site probably benign
IGL00470:Lama2 APN 10 27,243,742 (GRCm38) missense probably benign 0.22
IGL00517:Lama2 APN 10 27,197,330 (GRCm38) missense probably benign 0.01
IGL00541:Lama2 APN 10 27,188,306 (GRCm38) missense probably benign 0.14
IGL00931:Lama2 APN 10 27,006,776 (GRCm38) missense possibly damaging 0.92
IGL00951:Lama2 APN 10 27,030,285 (GRCm38) missense probably benign 0.03
IGL00988:Lama2 APN 10 27,369,015 (GRCm38) nonsense probably null
IGL01098:Lama2 APN 10 27,031,112 (GRCm38) missense possibly damaging 0.66
IGL01152:Lama2 APN 10 27,208,429 (GRCm38) missense probably benign 0.00
IGL01293:Lama2 APN 10 27,231,636 (GRCm38) missense probably benign 0.38
IGL01338:Lama2 APN 10 27,188,272 (GRCm38) missense probably benign 0.13
IGL01609:Lama2 APN 10 27,344,421 (GRCm38) missense probably benign 0.03
IGL01643:Lama2 APN 10 27,070,372 (GRCm38) splice site probably benign
IGL01675:Lama2 APN 10 27,188,054 (GRCm38) missense possibly damaging 0.77
IGL01681:Lama2 APN 10 27,265,045 (GRCm38) missense probably benign 0.33
IGL01694:Lama2 APN 10 27,006,742 (GRCm38) missense possibly damaging 0.75
IGL01705:Lama2 APN 10 27,189,274 (GRCm38) splice site probably benign
IGL01885:Lama2 APN 10 27,105,139 (GRCm38) nonsense probably null
IGL01935:Lama2 APN 10 27,422,604 (GRCm38) missense probably damaging 0.98
IGL01994:Lama2 APN 10 27,467,203 (GRCm38) critical splice donor site probably null
IGL02041:Lama2 APN 10 26,984,326 (GRCm38) missense probably damaging 1.00
IGL02067:Lama2 APN 10 27,176,796 (GRCm38) missense probably benign 0.02
IGL02097:Lama2 APN 10 27,138,960 (GRCm38) missense probably benign 0.09
IGL02179:Lama2 APN 10 27,070,364 (GRCm38) missense probably benign 0.01
IGL02268:Lama2 APN 10 27,001,116 (GRCm38) splice site probably benign
IGL02302:Lama2 APN 10 27,212,043 (GRCm38) missense probably benign 0.06
IGL02363:Lama2 APN 10 27,366,066 (GRCm38) missense probably damaging 1.00
IGL02378:Lama2 APN 10 27,043,656 (GRCm38) missense probably damaging 0.99
IGL02642:Lama2 APN 10 27,467,273 (GRCm38) missense probably damaging 1.00
IGL02676:Lama2 APN 10 27,118,493 (GRCm38) missense probably benign 0.00
IGL02695:Lama2 APN 10 27,000,775 (GRCm38) missense probably benign
IGL02735:Lama2 APN 10 27,104,128 (GRCm38) missense probably damaging 1.00
IGL02794:Lama2 APN 10 27,041,231 (GRCm38) missense possibly damaging 0.73
IGL02823:Lama2 APN 10 27,001,145 (GRCm38) missense probably damaging 1.00
IGL02869:Lama2 APN 10 27,015,538 (GRCm38) missense probably damaging 0.99
IGL02942:Lama2 APN 10 27,041,220 (GRCm38) missense probably damaging 1.00
IGL03201:Lama2 APN 10 27,344,570 (GRCm38) nonsense probably null
IGL03268:Lama2 APN 10 27,422,653 (GRCm38) missense probably damaging 1.00
IGL03288:Lama2 APN 10 27,369,051 (GRCm38) missense probably damaging 1.00
IGL03380:Lama2 APN 10 27,050,265 (GRCm38) missense probably damaging 1.00
IGL03407:Lama2 APN 10 27,347,021 (GRCm38) missense probably damaging 1.00
cowboy UTSW 10 27,043,643 (GRCm38) frame shift probably null
petri UTSW 10 26,993,398 (GRCm38) splice site probably null
PIT4362001:Lama2 UTSW 10 27,369,136 (GRCm38) missense probably damaging 1.00
PIT4382001:Lama2 UTSW 10 27,204,905 (GRCm38) missense probably damaging 1.00
PIT4431001:Lama2 UTSW 10 27,101,430 (GRCm38) missense probably damaging 1.00
R0038:Lama2 UTSW 10 26,986,797 (GRCm38) missense probably benign 0.02
R0038:Lama2 UTSW 10 26,986,797 (GRCm38) missense probably benign 0.02
R0114:Lama2 UTSW 10 26,993,068 (GRCm38) nonsense probably null
R0142:Lama2 UTSW 10 27,187,845 (GRCm38) missense probably benign
R0313:Lama2 UTSW 10 26,993,398 (GRCm38) splice site probably null
R0376:Lama2 UTSW 10 27,015,546 (GRCm38) missense possibly damaging 0.68
R0412:Lama2 UTSW 10 27,190,625 (GRCm38) missense possibly damaging 0.58
R0472:Lama2 UTSW 10 26,990,867 (GRCm38) missense probably damaging 1.00
R0607:Lama2 UTSW 10 27,189,131 (GRCm38) missense probably benign 0.34
R0648:Lama2 UTSW 10 26,989,376 (GRCm38) missense probably benign 0.00
R0667:Lama2 UTSW 10 27,344,410 (GRCm38) splice site probably null
R0760:Lama2 UTSW 10 27,044,433 (GRCm38) critical splice donor site probably null
R1240:Lama2 UTSW 10 27,041,124 (GRCm38) missense probably damaging 1.00
R1385:Lama2 UTSW 10 27,224,043 (GRCm38) missense probably benign 0.11
R1433:Lama2 UTSW 10 27,187,754 (GRCm38) missense probably damaging 1.00
R1434:Lama2 UTSW 10 27,208,370 (GRCm38) missense probably damaging 1.00
R1574:Lama2 UTSW 10 27,324,754 (GRCm38) missense possibly damaging 0.65
R1574:Lama2 UTSW 10 27,324,754 (GRCm38) missense possibly damaging 0.65
R1645:Lama2 UTSW 10 27,368,985 (GRCm38) missense probably damaging 1.00
R1702:Lama2 UTSW 10 27,190,529 (GRCm38) missense probably benign
R1703:Lama2 UTSW 10 27,266,671 (GRCm38) missense probably damaging 1.00
R1769:Lama2 UTSW 10 27,208,406 (GRCm38) missense probably damaging 1.00
R1846:Lama2 UTSW 10 27,212,096 (GRCm38) missense probably damaging 1.00
R1859:Lama2 UTSW 10 27,031,082 (GRCm38) missense possibly damaging 0.51
R1871:Lama2 UTSW 10 26,984,494 (GRCm38) missense probably damaging 1.00
R1903:Lama2 UTSW 10 27,188,399 (GRCm38) missense probably damaging 1.00
R1906:Lama2 UTSW 10 27,056,527 (GRCm38) critical splice donor site probably null
R1958:Lama2 UTSW 10 26,981,598 (GRCm38) missense probably damaging 0.97
R1959:Lama2 UTSW 10 27,422,618 (GRCm38) missense probably damaging 1.00
R1977:Lama2 UTSW 10 26,990,800 (GRCm38) splice site probably null
R2063:Lama2 UTSW 10 27,164,926 (GRCm38) missense probably damaging 1.00
R2079:Lama2 UTSW 10 27,369,053 (GRCm38) missense probably damaging 0.99
R2085:Lama2 UTSW 10 27,204,841 (GRCm38) nonsense probably null
R2125:Lama2 UTSW 10 27,044,453 (GRCm38) nonsense probably null
R2140:Lama2 UTSW 10 27,054,694 (GRCm38) splice site probably null
R2219:Lama2 UTSW 10 27,043,569 (GRCm38) missense probably damaging 0.99
R2259:Lama2 UTSW 10 27,031,127 (GRCm38) missense probably benign 0.00
R2265:Lama2 UTSW 10 26,992,936 (GRCm38) missense probably damaging 1.00
R2266:Lama2 UTSW 10 26,986,797 (GRCm38) missense probably benign 0.02
R2267:Lama2 UTSW 10 26,992,936 (GRCm38) missense probably damaging 1.00
R2268:Lama2 UTSW 10 26,992,936 (GRCm38) missense probably damaging 1.00
R2269:Lama2 UTSW 10 26,992,936 (GRCm38) missense probably damaging 1.00
R2862:Lama2 UTSW 10 27,422,612 (GRCm38) nonsense probably null
R2912:Lama2 UTSW 10 27,000,803 (GRCm38) missense probably benign
R2999:Lama2 UTSW 10 26,989,421 (GRCm38) missense probably benign 0.18
R3034:Lama2 UTSW 10 27,001,235 (GRCm38) missense probably benign 0.11
R3081:Lama2 UTSW 10 27,001,235 (GRCm38) missense probably benign 0.11
R3107:Lama2 UTSW 10 27,001,235 (GRCm38) missense probably benign 0.11
R3109:Lama2 UTSW 10 27,001,235 (GRCm38) missense probably benign 0.11
R3436:Lama2 UTSW 10 27,001,235 (GRCm38) missense probably benign 0.11
R3437:Lama2 UTSW 10 27,001,235 (GRCm38) missense probably benign 0.11
R3706:Lama2 UTSW 10 27,138,996 (GRCm38) missense probably damaging 1.00
R3780:Lama2 UTSW 10 27,459,339 (GRCm38) missense probably damaging 1.00
R3807:Lama2 UTSW 10 27,190,665 (GRCm38) frame shift probably null
R3919:Lama2 UTSW 10 27,118,505 (GRCm38) missense probably damaging 1.00
R4014:Lama2 UTSW 10 26,984,376 (GRCm38) missense probably damaging 1.00
R4131:Lama2 UTSW 10 27,041,174 (GRCm38) missense probably benign 0.00
R4190:Lama2 UTSW 10 27,266,664 (GRCm38) missense probably damaging 0.96
R4273:Lama2 UTSW 10 27,347,054 (GRCm38) missense probably damaging 1.00
R4358:Lama2 UTSW 10 26,984,493 (GRCm38) missense probably damaging 1.00
R4407:Lama2 UTSW 10 27,212,128 (GRCm38) small deletion probably benign
R4415:Lama2 UTSW 10 26,989,344 (GRCm38) nonsense probably null
R4426:Lama2 UTSW 10 27,422,558 (GRCm38) missense probably damaging 1.00
R4590:Lama2 UTSW 10 26,989,414 (GRCm38) missense probably benign 0.00
R4615:Lama2 UTSW 10 26,981,524 (GRCm38) missense probably damaging 0.99
R4736:Lama2 UTSW 10 27,204,929 (GRCm38) missense probably damaging 1.00
R4754:Lama2 UTSW 10 27,118,531 (GRCm38) missense possibly damaging 0.58
R4791:Lama2 UTSW 10 27,467,271 (GRCm38) missense probably damaging 1.00
R4834:Lama2 UTSW 10 27,006,749 (GRCm38) missense probably benign 0.30
R4856:Lama2 UTSW 10 27,043,643 (GRCm38) frame shift probably null
R4858:Lama2 UTSW 10 27,043,643 (GRCm38) frame shift probably null
R4859:Lama2 UTSW 10 27,043,643 (GRCm38) frame shift probably null
R4897:Lama2 UTSW 10 27,043,643 (GRCm38) frame shift probably null
R4898:Lama2 UTSW 10 27,043,643 (GRCm38) frame shift probably null
R4899:Lama2 UTSW 10 27,043,643 (GRCm38) frame shift probably null
R4907:Lama2 UTSW 10 27,164,946 (GRCm38) missense probably benign 0.11
R4911:Lama2 UTSW 10 27,138,927 (GRCm38) missense probably damaging 1.00
R4924:Lama2 UTSW 10 27,369,141 (GRCm38) missense probably damaging 0.98
R5023:Lama2 UTSW 10 27,190,504 (GRCm38) missense probably damaging 0.97
R5057:Lama2 UTSW 10 27,164,986 (GRCm38) missense probably damaging 1.00
R5070:Lama2 UTSW 10 27,350,251 (GRCm38) critical splice donor site probably null
R5116:Lama2 UTSW 10 27,118,560 (GRCm38) missense probably benign 0.08
R5177:Lama2 UTSW 10 27,190,703 (GRCm38) missense possibly damaging 0.94
R5198:Lama2 UTSW 10 27,347,003 (GRCm38) missense probably damaging 0.96
R5289:Lama2 UTSW 10 27,212,073 (GRCm38) nonsense probably null
R5327:Lama2 UTSW 10 27,138,946 (GRCm38) missense probably benign
R5424:Lama2 UTSW 10 26,984,396 (GRCm38) missense probably damaging 1.00
R5469:Lama2 UTSW 10 27,041,189 (GRCm38) missense possibly damaging 0.92
R5620:Lama2 UTSW 10 26,990,880 (GRCm38) missense probably damaging 0.99
R5667:Lama2 UTSW 10 27,190,544 (GRCm38) missense probably damaging 1.00
R5671:Lama2 UTSW 10 27,190,544 (GRCm38) missense probably damaging 1.00
R5815:Lama2 UTSW 10 26,986,851 (GRCm38) missense probably damaging 1.00
R5917:Lama2 UTSW 10 27,190,697 (GRCm38) missense probably damaging 1.00
R5935:Lama2 UTSW 10 27,015,498 (GRCm38) missense probably benign
R5976:Lama2 UTSW 10 27,190,676 (GRCm38) missense probably benign 0.00
R5979:Lama2 UTSW 10 27,235,732 (GRCm38) missense probably damaging 0.99
R6004:Lama2 UTSW 10 27,235,785 (GRCm38) missense probably benign 0.01
R6180:Lama2 UTSW 10 26,981,499 (GRCm38) missense probably benign 0.03
R6198:Lama2 UTSW 10 27,188,022 (GRCm38) missense probably damaging 1.00
R6257:Lama2 UTSW 10 26,986,899 (GRCm38) missense possibly damaging 0.85
R6271:Lama2 UTSW 10 27,023,329 (GRCm38) missense possibly damaging 0.67
R6322:Lama2 UTSW 10 27,190,547 (GRCm38) missense probably damaging 0.96
R6354:Lama2 UTSW 10 27,212,068 (GRCm38) missense probably damaging 1.00
R6431:Lama2 UTSW 10 27,053,031 (GRCm38) missense possibly damaging 0.50
R6499:Lama2 UTSW 10 27,031,158 (GRCm38) missense probably damaging 1.00
R6535:Lama2 UTSW 10 27,104,131 (GRCm38) missense probably damaging 1.00
R6545:Lama2 UTSW 10 27,176,797 (GRCm38) missense probably benign
R6636:Lama2 UTSW 10 27,124,568 (GRCm38) missense probably benign 0.13
R6891:Lama2 UTSW 10 27,328,082 (GRCm38) nonsense probably null
R6891:Lama2 UTSW 10 27,328,072 (GRCm38) nonsense probably null
R6902:Lama2 UTSW 10 26,981,629 (GRCm38) missense probably damaging 1.00
R6908:Lama2 UTSW 10 27,031,196 (GRCm38) splice site probably null
R7168:Lama2 UTSW 10 27,366,152 (GRCm38) critical splice acceptor site probably null
R7233:Lama2 UTSW 10 27,231,663 (GRCm38) missense probably damaging 1.00
R7272:Lama2 UTSW 10 27,124,556 (GRCm38) missense probably damaging 1.00
R7274:Lama2 UTSW 10 27,119,980 (GRCm38) missense probably damaging 0.99
R7419:Lama2 UTSW 10 27,266,634 (GRCm38) missense probably benign
R7423:Lama2 UTSW 10 27,212,226 (GRCm38) missense probably benign 0.00
R7554:Lama2 UTSW 10 27,155,496 (GRCm38) missense probably damaging 1.00
R7569:Lama2 UTSW 10 27,265,050 (GRCm38) missense probably damaging 1.00
R7574:Lama2 UTSW 10 27,006,730 (GRCm38) missense probably benign 0.03
R7584:Lama2 UTSW 10 27,104,261 (GRCm38) missense possibly damaging 0.78
R7586:Lama2 UTSW 10 27,101,393 (GRCm38) missense probably benign 0.00
R7603:Lama2 UTSW 10 27,266,680 (GRCm38) missense possibly damaging 0.55
R7691:Lama2 UTSW 10 27,208,393 (GRCm38) missense possibly damaging 0.67
R7750:Lama2 UTSW 10 26,990,924 (GRCm38) missense probably damaging 0.97
R7841:Lama2 UTSW 10 27,155,533 (GRCm38) missense probably benign 0.00
R7864:Lama2 UTSW 10 27,056,615 (GRCm38) missense probably benign 0.08
R7960:Lama2 UTSW 10 26,993,098 (GRCm38) missense probably benign 0.04
R7964:Lama2 UTSW 10 27,223,981 (GRCm38) critical splice donor site probably null
R7980:Lama2 UTSW 10 27,363,613 (GRCm38) missense probably damaging 0.98
R8013:Lama2 UTSW 10 27,344,498 (GRCm38) missense probably benign 0.00
R8028:Lama2 UTSW 10 27,328,149 (GRCm38) missense probably benign 0.13
R8097:Lama2 UTSW 10 27,190,664 (GRCm38) nonsense probably null
R8100:Lama2 UTSW 10 27,041,117 (GRCm38) missense probably benign 0.03
R8110:Lama2 UTSW 10 26,990,870 (GRCm38) missense probably damaging 1.00
R8122:Lama2 UTSW 10 27,054,596 (GRCm38) missense possibly damaging 0.87
R8264:Lama2 UTSW 10 27,467,222 (GRCm38) missense probably benign 0.07
R8315:Lama2 UTSW 10 27,422,659 (GRCm38) missense probably damaging 1.00
R8318:Lama2 UTSW 10 26,984,338 (GRCm38) missense probably damaging 1.00
R8419:Lama2 UTSW 10 27,422,563 (GRCm38) missense probably benign 0.26
R8475:Lama2 UTSW 10 27,101,373 (GRCm38) missense possibly damaging 0.69
R8735:Lama2 UTSW 10 27,190,534 (GRCm38) missense probably damaging 1.00
R8754:Lama2 UTSW 10 27,001,151 (GRCm38) missense possibly damaging 0.83
R8817:Lama2 UTSW 10 27,187,873 (GRCm38) missense probably damaging 1.00
R8851:Lama2 UTSW 10 27,366,123 (GRCm38) missense possibly damaging 0.94
R8859:Lama2 UTSW 10 27,459,388 (GRCm38) missense possibly damaging 0.58
R8886:Lama2 UTSW 10 27,369,161 (GRCm38) splice site probably benign
R8937:Lama2 UTSW 10 26,986,820 (GRCm38) missense probably damaging 1.00
R8993:Lama2 UTSW 10 27,422,714 (GRCm38) missense possibly damaging 0.91
R9025:Lama2 UTSW 10 26,984,371 (GRCm38) missense probably benign 0.00
R9027:Lama2 UTSW 10 27,204,885 (GRCm38) missense probably damaging 1.00
R9047:Lama2 UTSW 10 27,006,701 (GRCm38) missense possibly damaging 0.50
R9075:Lama2 UTSW 10 26,981,592 (GRCm38) missense probably damaging 1.00
R9135:Lama2 UTSW 10 27,422,519 (GRCm38) missense probably damaging 1.00
R9165:Lama2 UTSW 10 27,053,026 (GRCm38) critical splice donor site probably null
R9192:Lama2 UTSW 10 27,328,185 (GRCm38) missense possibly damaging 0.95
R9254:Lama2 UTSW 10 27,422,689 (GRCm38) missense probably damaging 0.96
R9326:Lama2 UTSW 10 27,030,197 (GRCm38) missense probably benign 0.04
R9356:Lama2 UTSW 10 27,212,190 (GRCm38) missense probably damaging 0.99
R9358:Lama2 UTSW 10 27,616,765 (GRCm38) missense unknown
R9358:Lama2 UTSW 10 27,188,382 (GRCm38) missense possibly damaging 0.95
R9376:Lama2 UTSW 10 27,118,624 (GRCm38) missense probably benign 0.11
R9381:Lama2 UTSW 10 27,188,027 (GRCm38) nonsense probably null
R9397:Lama2 UTSW 10 27,105,121 (GRCm38) missense probably benign 0.01
R9460:Lama2 UTSW 10 27,422,479 (GRCm38) missense probably damaging 1.00
R9478:Lama2 UTSW 10 27,015,482 (GRCm38) missense probably damaging 0.98
R9503:Lama2 UTSW 10 26,989,444 (GRCm38) missense possibly damaging 0.57
R9514:Lama2 UTSW 10 27,224,019 (GRCm38) missense probably benign 0.00
R9515:Lama2 UTSW 10 27,001,174 (GRCm38) missense probably benign 0.23
R9516:Lama2 UTSW 10 27,224,019 (GRCm38) missense probably benign 0.00
R9533:Lama2 UTSW 10 26,986,875 (GRCm38) missense probably damaging 1.00
R9619:Lama2 UTSW 10 27,188,286 (GRCm38) missense probably damaging 1.00
R9721:Lama2 UTSW 10 27,467,342 (GRCm38) missense possibly damaging 0.58
Predicted Primers PCR Primer
(F):5'- ACAGGCTCAATGCACCTGCCTTAG -3'
(R):5'- TGTCATACGGATTTTCAGCCCTGC -3'

Sequencing Primer
(F):5'- GGTGGTGTTCACTAACCTCAAAAG -3'
(R):5'- GATTTTCAGCCCTGCAAATCTTG -3'
Posted On 2014-05-23