Incidental Mutation 'R1874:Vwa7'
ID211097
Institutional Source Beutler Lab
Gene Symbol Vwa7
Ensembl Gene ENSMUSG00000007030
Gene Namevon Willebrand factor A domain containing 7
SynonymsD17H6S56E-3, G7c
MMRRC Submission 039896-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.055) question?
Stock #R1874 (G1)
Quality Score225
Status Validated
Chromosome17
Chromosomal Location35016579-35026741 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to G at 35017112 bp
ZygosityHeterozygous
Amino Acid Change Proline to Arginine at position 14 (P14R)
Ref Sequence ENSEMBL: ENSMUSP00000133418 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000007245] [ENSMUST00000087315] [ENSMUST00000172499] [ENSMUST00000173584]
Predicted Effect probably benign
Transcript: ENSMUST00000007245
AA Change: P14R

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000007245
Gene: ENSMUSG00000007030
AA Change: P14R

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
VWA 314 499 2.59e0 SMART
low complexity region 683 701 N/A INTRINSIC
low complexity region 840 861 N/A INTRINSIC
low complexity region 864 877 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000087315
SMART Domains Protein: ENSMUSP00000084572
Gene: ENSMUSG00000007029

DomainStartEndE-ValueType
Pfam:GST_N 2 81 5.7e-16 PFAM
Pfam:GST_C 107 198 7.3e-13 PFAM
low complexity region 234 256 N/A INTRINSIC
low complexity region 261 271 N/A INTRINSIC
Pfam:tRNA-synt_1 307 938 2e-197 PFAM
Pfam:tRNA-synt_1g 336 496 6e-6 PFAM
Pfam:tRNA-synt_1_2 555 623 1.9e-11 PFAM
Pfam:Anticodon_1 983 1138 2.6e-34 PFAM
low complexity region 1153 1174 N/A INTRINSIC
low complexity region 1207 1225 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000172499
AA Change: P14R

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000133418
Gene: ENSMUSG00000007030
AA Change: P14R

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
VWA 314 478 7.28e0 SMART
low complexity region 662 680 N/A INTRINSIC
low complexity region 819 840 N/A INTRINSIC
low complexity region 843 856 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000172637
Predicted Effect noncoding transcript
Transcript: ENSMUST00000172999
Predicted Effect probably benign
Transcript: ENSMUST00000173142
SMART Domains Protein: ENSMUSP00000134669
Gene: ENSMUSG00000007029

DomainStartEndE-ValueType
SCOP:d1gaxa3 32 67 3e-7 SMART
PDB:1IYW|B 36 122 4e-6 PDB
Predicted Effect noncoding transcript
Transcript: ENSMUST00000173302
Predicted Effect noncoding transcript
Transcript: ENSMUST00000173336
Predicted Effect probably benign
Transcript: ENSMUST00000173584
SMART Domains Protein: ENSMUSP00000133994
Gene: ENSMUSG00000007029

DomainStartEndE-ValueType
low complexity region 25 38 N/A INTRINSIC
low complexity region 44 58 N/A INTRINSIC
low complexity region 78 89 N/A INTRINSIC
Pfam:GST_C 96 198 7.8e-14 PFAM
low complexity region 234 256 N/A INTRINSIC
low complexity region 261 271 N/A INTRINSIC
Pfam:tRNA-synt_1 307 938 1.9e-200 PFAM
Pfam:tRNA-synt_1g 336 493 2.1e-7 PFAM
Pfam:tRNA-synt_1_2 555 623 1.1e-12 PFAM
Pfam:Anticodon_1 983 1138 7.2e-36 PFAM
low complexity region 1153 1174 N/A INTRINSIC
coiled coil region 1197 1225 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000173911
Predicted Effect noncoding transcript
Transcript: ENSMUST00000174084
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 97.5%
  • 3x: 97.0%
  • 10x: 95.8%
  • 20x: 94.1%
Validation Efficiency 96% (105/109)
Allele List at MGI
Other mutations in this stock
Total: 104 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
AA986860 A G 1: 130,742,691 S217G probably benign Het
Adrb3 C A 8: 27,227,563 R286L probably damaging Het
Akap11 T A 14: 78,511,866 D1027V probably benign Het
Ank3 A T 10: 69,898,083 I726F probably damaging Het
Ankmy2 T A 12: 36,165,931 D43E possibly damaging Het
Ankrd34b A G 13: 92,439,556 D432G probably damaging Het
Ano3 A C 2: 110,884,872 S74A probably benign Het
B4galnt4 T A 7: 141,070,526 S769T probably damaging Het
Bicral T A 17: 46,825,178 T369S probably benign Het
Blm A G 7: 80,497,418 L738P probably damaging Het
Bpifb3 A G 2: 153,925,840 T278A probably benign Het
Bpifb5 A G 2: 154,227,202 probably benign Het
Brd8 G C 18: 34,610,474 P266R probably damaging Het
Btaf1 A T 19: 36,980,583 M587L probably benign Het
Casz1 C G 4: 148,943,211 T1015S probably damaging Het
Cdh23 A G 10: 60,436,818 I524T possibly damaging Het
Celsr3 T C 9: 108,835,838 V1825A probably benign Het
Cenpf A G 1: 189,683,816 L104P probably damaging Het
Clasp1 G T 1: 118,600,585 probably null Het
Coprs A G 8: 13,885,112 W148R probably damaging Het
Cpne1 A G 2: 156,078,382 S168P probably damaging Het
Cpxm2 T C 7: 132,059,834 Y408C probably damaging Het
Ctnna3 A G 10: 63,504,107 E24G possibly damaging Het
Cubn T A 2: 13,323,002 S2671C probably damaging Het
Cyp4f39 T A 17: 32,483,324 F265Y probably damaging Het
Dgkq C A 5: 108,660,595 R34L probably benign Het
Dnajc7 C T 11: 100,599,313 probably benign Het
Eml6 T G 11: 29,831,136 D632A probably damaging Het
Fbxl18 G A 5: 142,886,223 A419V probably damaging Het
Fbxw22 A T 9: 109,385,111 C212* probably null Het
Ffar2 A G 7: 30,819,414 probably null Het
Fga A T 3: 83,032,721 T561S probably damaging Het
Fry A G 5: 150,345,921 Y159C probably damaging Het
Gal3st1 A G 11: 3,998,231 Y146C probably damaging Het
Gapvd1 A T 2: 34,706,021 H788Q probably damaging Het
Gimap7 G A 6: 48,723,515 V12I possibly damaging Het
Gli2 C A 1: 119,002,049 A43S possibly damaging Het
Gm15446 T C 5: 109,942,553 F224L probably damaging Het
Gm21738 C T 14: 19,418,824 V35I possibly damaging Het
Grhl1 T C 12: 24,586,156 probably benign Het
Grk6 T C 13: 55,450,273 Y53H probably damaging Het
Hcar1 C T 5: 123,879,265 R121K probably damaging Het
Hmcn1 A C 1: 150,720,695 S1797A probably damaging Het
Hsd17b7 A T 1: 169,955,993 L282Q possibly damaging Het
Irs1 TTCTCTGAGTGGCCACAGCGTCT TTCT 1: 82,289,853 probably null Het
Kif1b C T 4: 149,187,632 V1571I probably benign Het
Lpl T A 8: 68,896,619 C266S probably damaging Het
Mag G A 7: 30,909,051 H213Y probably benign Het
Mansc4 T G 6: 147,075,190 R309S probably benign Het
Mlh3 A G 12: 85,237,513 probably null Het
Mndal G A 1: 173,860,367 probably benign Het
Mrgpra2b T A 7: 47,463,994 E330V probably damaging Het
Myh3 A G 11: 67,093,179 I990V probably benign Het
Myoz2 A T 3: 123,026,116 S65T probably damaging Het
Naa16 T C 14: 79,355,743 E463G possibly damaging Het
Nadsyn1 A G 7: 143,797,844 F684S probably damaging Het
Notch1 T C 2: 26,481,579 E286G possibly damaging Het
Nynrin A T 14: 55,863,493 I247L probably benign Het
Olfr136 C T 17: 38,335,969 P271S probably damaging Het
Olfr644 T C 7: 104,068,129 I301V probably null Het
Olfr981 T A 9: 40,022,855 I154N possibly damaging Het
Oprm1 A G 10: 6,789,035 H54R probably benign Het
P4hb C T 11: 120,562,166 D483N probably benign Het
Pak1 T C 7: 97,871,580 S149P probably benign Het
Pars2 T C 4: 106,653,716 F232L possibly damaging Het
Pih1d2 A G 9: 50,620,945 M88V possibly damaging Het
Pms1 A T 1: 53,207,233 N382K probably benign Het
Pnliprp2 G T 19: 58,763,389 V189L probably benign Het
Pole G A 5: 110,323,664 V1425M possibly damaging Het
Pot1b T A 17: 55,654,805 Q591L probably benign Het
Ppp1r9a C T 6: 4,906,348 T301M possibly damaging Het
Psg21 T C 7: 18,650,816 E335G probably benign Het
Ptpru T A 4: 131,769,755 M1416L probably benign Het
Pxn T C 5: 115,544,990 V117A probably damaging Het
Qsox1 C T 1: 155,812,639 R54H possibly damaging Het
Rad1 A G 15: 10,488,006 E42G probably damaging Het
Rpp14 A G 14: 8,090,145 Y23C probably benign Het
Sdk2 C T 11: 113,834,956 V1156I probably benign Het
Serpina3j G T 12: 104,319,699 R371L probably benign Het
Serpinb9d T A 13: 33,197,963 probably null Het
Sirt5 C T 13: 43,370,791 S13F possibly damaging Het
Slc6a7 T A 18: 61,001,398 probably benign Het
Slx4 A G 16: 3,986,848 S701P probably benign Het
Snx29 A G 16: 11,367,681 T43A probably benign Het
Speg T C 1: 75,423,906 V2570A probably benign Het
Srrm4 T A 5: 116,453,506 probably benign Het
Stk32a A G 18: 43,261,316 Y110C probably damaging Het
Tbc1d31 G A 15: 57,916,110 G73E probably benign Het
Thsd7a A T 6: 12,555,435 I150N possibly damaging Het
Tjp1 A T 7: 65,319,253 D699E probably damaging Het
Tmem143 A G 7: 45,916,564 D437G possibly damaging Het
Tmem45a2 A G 16: 57,047,084 Y85H possibly damaging Het
Tmem45b T A 9: 31,429,087 T7S probably damaging Het
Ube4b A G 4: 149,347,971 L832P probably damaging Het
Ugp2 G T 11: 21,329,048 F379L probably damaging Het
Ugt3a2 A T 15: 9,365,351 D350V probably damaging Het
Vmn2r8 T A 5: 108,802,418 T188S possibly damaging Het
Vwc2 C A 11: 11,261,495 T317K probably damaging Het
Vwf A T 6: 125,628,372 Q906L probably benign Het
Wdr49 A G 3: 75,429,347 V351A probably damaging Het
Wdr7 A G 18: 63,728,504 S196G probably benign Het
Xkr6 C A 14: 63,798,296 A26E unknown Het
Zcchc11 T A 4: 108,550,725 V1397D probably damaging Het
Zfp955b T C 17: 33,305,453 I47V probably benign Het
Other mutations in Vwa7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01103:Vwa7 APN 17 35024942 missense probably damaging 1.00
IGL01736:Vwa7 APN 17 35019851 missense probably damaging 1.00
IGL01868:Vwa7 APN 17 35021259 missense probably null 0.96
IGL01920:Vwa7 APN 17 35024603 missense probably benign 0.01
IGL02227:Vwa7 APN 17 35020084 missense probably damaging 1.00
IGL02947:Vwa7 APN 17 35023500 splice site probably null
IGL03259:Vwa7 APN 17 35020026 unclassified probably null
IGL03263:Vwa7 APN 17 35021599 missense probably benign 0.16
R0008:Vwa7 UTSW 17 35019805 missense probably benign 0.33
R0057:Vwa7 UTSW 17 35024547 missense possibly damaging 0.85
R0057:Vwa7 UTSW 17 35024547 missense possibly damaging 0.85
R0418:Vwa7 UTSW 17 35017957 missense possibly damaging 0.57
R0538:Vwa7 UTSW 17 35022651 missense probably damaging 1.00
R1121:Vwa7 UTSW 17 35017794 missense probably damaging 1.00
R1659:Vwa7 UTSW 17 35019071 missense probably benign 0.04
R1766:Vwa7 UTSW 17 35023943 critical splice donor site probably null
R1777:Vwa7 UTSW 17 35024948 missense probably damaging 1.00
R1793:Vwa7 UTSW 17 35024412 nonsense probably null
R2139:Vwa7 UTSW 17 35023430 missense probably benign 0.00
R2248:Vwa7 UTSW 17 35019043 missense probably benign 0.04
R2290:Vwa7 UTSW 17 35017211 missense probably damaging 1.00
R2869:Vwa7 UTSW 17 35021242 missense probably damaging 1.00
R2869:Vwa7 UTSW 17 35021242 missense probably damaging 1.00
R2870:Vwa7 UTSW 17 35021242 missense probably damaging 1.00
R2870:Vwa7 UTSW 17 35021242 missense probably damaging 1.00
R2871:Vwa7 UTSW 17 35021242 missense probably damaging 1.00
R2871:Vwa7 UTSW 17 35021242 missense probably damaging 1.00
R2873:Vwa7 UTSW 17 35021242 missense probably damaging 1.00
R2874:Vwa7 UTSW 17 35021242 missense probably damaging 1.00
R3038:Vwa7 UTSW 17 35022661 missense probably damaging 1.00
R3792:Vwa7 UTSW 17 35025159 unclassified probably null
R3970:Vwa7 UTSW 17 35017708 missense probably damaging 1.00
R4612:Vwa7 UTSW 17 35023450 missense probably damaging 0.96
R5013:Vwa7 UTSW 17 35022733 missense probably damaging 1.00
R5068:Vwa7 UTSW 17 35024190 missense probably benign 0.25
R5069:Vwa7 UTSW 17 35024190 missense probably benign 0.25
R5070:Vwa7 UTSW 17 35024190 missense probably benign 0.25
R5137:Vwa7 UTSW 17 35017846 missense probably damaging 1.00
R5384:Vwa7 UTSW 17 35024926 unclassified probably null
R6170:Vwa7 UTSW 17 35021210 missense possibly damaging 0.56
R6229:Vwa7 UTSW 17 35024265 missense probably benign 0.00
R6249:Vwa7 UTSW 17 35023389 missense probably benign 0.00
R6401:Vwa7 UTSW 17 35017310 splice site probably null
R6429:Vwa7 UTSW 17 35024199 missense probably benign 0.32
R6678:Vwa7 UTSW 17 35019800 missense probably damaging 1.00
R6793:Vwa7 UTSW 17 35024891 missense probably benign 0.06
R6966:Vwa7 UTSW 17 35017096 missense probably benign
R7492:Vwa7 UTSW 17 35019044 missense possibly damaging 0.86
Predicted Primers PCR Primer
(F):5'- AGCCACCCTGGAGTATATGG -3'
(R):5'- AACCCCAGGTGAATCTAAGGTG -3'

Sequencing Primer
(F):5'- ACCCTGGAGTATATGGGGCAC -3'
(R):5'- CCAGGTGAATCTAAGGTGCTCAC -3'
Posted On2014-06-30