Incidental Mutation 'R1874:Akap11'
ID 211086
Institutional Source Beutler Lab
Gene Symbol Akap11
Ensembl Gene ENSMUSG00000022016
Gene Name A kinase (PRKA) anchor protein 11
Synonyms 6330501D17Rik
MMRRC Submission 039896-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R1874 (G1)
Quality Score 225
Status Validated
Chromosome 14
Chromosomal Location 78492246-78536808 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 78511866 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Valine at position 1027 (D1027V)
Ref Sequence ENSEMBL: ENSMUSP00000116015 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022593] [ENSMUST00000123853]
AlphaFold E9Q777
Predicted Effect probably benign
Transcript: ENSMUST00000022593
AA Change: D1027V

PolyPhen 2 Score 0.141 (Sensitivity: 0.92; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000022593
Gene: ENSMUSG00000022016
AA Change: D1027V

low complexity region 108 121 N/A INTRINSIC
low complexity region 170 179 N/A INTRINSIC
low complexity region 265 275 N/A INTRINSIC
low complexity region 302 318 N/A INTRINSIC
low complexity region 344 365 N/A INTRINSIC
low complexity region 528 539 N/A INTRINSIC
low complexity region 609 623 N/A INTRINSIC
low complexity region 727 741 N/A INTRINSIC
low complexity region 1161 1173 N/A INTRINSIC
low complexity region 1597 1614 N/A INTRINSIC
low complexity region 1631 1648 N/A INTRINSIC
low complexity region 1738 1755 N/A INTRINSIC
low complexity region 1767 1788 N/A INTRINSIC
Blast:AKAP_110 1790 1883 2e-8 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000123853
AA Change: D1027V

PolyPhen 2 Score 0.141 (Sensitivity: 0.92; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000116015
Gene: ENSMUSG00000022016
AA Change: D1027V

low complexity region 108 121 N/A INTRINSIC
low complexity region 170 179 N/A INTRINSIC
low complexity region 265 275 N/A INTRINSIC
low complexity region 302 318 N/A INTRINSIC
low complexity region 344 365 N/A INTRINSIC
low complexity region 528 539 N/A INTRINSIC
low complexity region 609 623 N/A INTRINSIC
low complexity region 727 741 N/A INTRINSIC
low complexity region 1161 1173 N/A INTRINSIC
low complexity region 1597 1614 N/A INTRINSIC
low complexity region 1631 1648 N/A INTRINSIC
low complexity region 1731 1756 N/A INTRINSIC
low complexity region 1768 1789 N/A INTRINSIC
Blast:AKAP_110 1791 1884 2e-8 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000226416
Predicted Effect noncoding transcript
Transcript: ENSMUST00000227722
Meta Mutation Damage Score 0.0856 question?
Coding Region Coverage
  • 1x: 97.5%
  • 3x: 97.0%
  • 10x: 95.8%
  • 20x: 94.1%
Validation Efficiency 96% (105/109)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The A-kinase anchor proteins (AKAPs) are a group of structurally diverse proteins, which have the common function of binding to the regulatory subunit of protein kinase A (PKA) and confining the holoenzyme to discrete locations within the cell. This gene encodes a member of the AKAP family. The encoded protein is expressed at high levels throughout spermatogenesis and in mature sperm. It binds the RI and RII subunits of PKA in testis. It may serve a function in cell cycle control of both somatic cells and germ cells in addition to its putative role in spermatogenesis and sperm function. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele show a reduction in body size, body length and tibia length, hypoactivity, slow movement and increased anxiety-related responses, and exhibit actin barrier defects in kidney collecting duct cells and increased urine osmolality in response to overhydration. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 104 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
AA986860 A G 1: 130,742,691 S217G probably benign Het
Adrb3 C A 8: 27,227,563 R286L probably damaging Het
Ank3 A T 10: 69,898,083 I726F probably damaging Het
Ankmy2 T A 12: 36,165,931 D43E possibly damaging Het
Ankrd34b A G 13: 92,439,556 D432G probably damaging Het
Ano3 A C 2: 110,884,872 S74A probably benign Het
B4galnt4 T A 7: 141,070,526 S769T probably damaging Het
Bicral T A 17: 46,825,178 T369S probably benign Het
Blm A G 7: 80,497,418 L738P probably damaging Het
Bpifb3 A G 2: 153,925,840 T278A probably benign Het
Bpifb5 A G 2: 154,227,202 probably benign Het
Brd8 G C 18: 34,610,474 P266R probably damaging Het
Btaf1 A T 19: 36,980,583 M587L probably benign Het
Casz1 C G 4: 148,943,211 T1015S probably damaging Het
Cdh23 A G 10: 60,436,818 I524T possibly damaging Het
Celsr3 T C 9: 108,835,838 V1825A probably benign Het
Cenpf A G 1: 189,683,816 L104P probably damaging Het
Clasp1 G T 1: 118,600,585 probably null Het
Coprs A G 8: 13,885,112 W148R probably damaging Het
Cpne1 A G 2: 156,078,382 S168P probably damaging Het
Cpxm2 T C 7: 132,059,834 Y408C probably damaging Het
Ctnna3 A G 10: 63,504,107 E24G possibly damaging Het
Cubn T A 2: 13,323,002 S2671C probably damaging Het
Cyp4f39 T A 17: 32,483,324 F265Y probably damaging Het
Dgkq C A 5: 108,660,595 R34L probably benign Het
Dnajc7 C T 11: 100,599,313 probably benign Het
Eml6 T G 11: 29,831,136 D632A probably damaging Het
Fbxl18 G A 5: 142,886,223 A419V probably damaging Het
Fbxw22 A T 9: 109,385,111 C212* probably null Het
Ffar2 A G 7: 30,819,414 probably null Het
Fga A T 3: 83,032,721 T561S probably damaging Het
Fry A G 5: 150,345,921 Y159C probably damaging Het
Gal3st1 A G 11: 3,998,231 Y146C probably damaging Het
Gapvd1 A T 2: 34,706,021 H788Q probably damaging Het
Gimap7 G A 6: 48,723,515 V12I possibly damaging Het
Gli2 C A 1: 119,002,049 A43S possibly damaging Het
Gm15446 T C 5: 109,942,553 F224L probably damaging Het
Gm21738 C T 14: 19,418,824 V35I possibly damaging Het
Grhl1 T C 12: 24,586,156 probably benign Het
Grk6 T C 13: 55,450,273 Y53H probably damaging Het
Hcar1 C T 5: 123,879,265 R121K probably damaging Het
Hmcn1 A C 1: 150,720,695 S1797A probably damaging Het
Hsd17b7 A T 1: 169,955,993 L282Q possibly damaging Het
Irs1 TTCTCTGAGTGGCCACAGCGTCT TTCT 1: 82,289,853 probably null Het
Kif1b C T 4: 149,187,632 V1571I probably benign Het
Lpl T A 8: 68,896,619 C266S probably damaging Het
Mag G A 7: 30,909,051 H213Y probably benign Het
Mansc4 T G 6: 147,075,190 R309S probably benign Het
Mlh3 A G 12: 85,237,513 probably null Het
Mndal G A 1: 173,860,367 probably benign Het
Mrgpra2b T A 7: 47,463,994 E330V probably damaging Het
Myh3 A G 11: 67,093,179 I990V probably benign Het
Myoz2 A T 3: 123,026,116 S65T probably damaging Het
Naa16 T C 14: 79,355,743 E463G possibly damaging Het
Nadsyn1 A G 7: 143,797,844 F684S probably damaging Het
Notch1 T C 2: 26,481,579 E286G possibly damaging Het
Nynrin A T 14: 55,863,493 I247L probably benign Het
Olfr136 C T 17: 38,335,969 P271S probably damaging Het
Olfr644 T C 7: 104,068,129 I301V probably null Het
Olfr981 T A 9: 40,022,855 I154N possibly damaging Het
Oprm1 A G 10: 6,789,035 H54R probably benign Het
P4hb C T 11: 120,562,166 D483N probably benign Het
Pak1 T C 7: 97,871,580 S149P probably benign Het
Pars2 T C 4: 106,653,716 F232L possibly damaging Het
Pih1d2 A G 9: 50,620,945 M88V possibly damaging Het
Pms1 A T 1: 53,207,233 N382K probably benign Het
Pnliprp2 G T 19: 58,763,389 V189L probably benign Het
Pole G A 5: 110,323,664 V1425M possibly damaging Het
Pot1b T A 17: 55,654,805 Q591L probably benign Het
Ppp1r9a C T 6: 4,906,348 T301M possibly damaging Het
Psg21 T C 7: 18,650,816 E335G probably benign Het
Ptpru T A 4: 131,769,755 M1416L probably benign Het
Pxn T C 5: 115,544,990 V117A probably damaging Het
Qsox1 C T 1: 155,812,639 R54H possibly damaging Het
Rad1 A G 15: 10,488,006 E42G probably damaging Het
Rpp14 A G 14: 8,090,145 Y23C probably benign Het
Sdk2 C T 11: 113,834,956 V1156I probably benign Het
Serpina3j G T 12: 104,319,699 R371L probably benign Het
Serpinb9d T A 13: 33,197,963 probably null Het
Sirt5 C T 13: 43,370,791 S13F possibly damaging Het
Slc6a7 T A 18: 61,001,398 probably benign Het
Slx4 A G 16: 3,986,848 S701P probably benign Het
Snx29 A G 16: 11,367,681 T43A probably benign Het
Speg T C 1: 75,423,906 V2570A probably benign Het
Srrm4 T A 5: 116,453,506 probably benign Het
Stk32a A G 18: 43,261,316 Y110C probably damaging Het
Tbc1d31 G A 15: 57,916,110 G73E probably benign Het
Thsd7a A T 6: 12,555,435 I150N possibly damaging Het
Tjp1 A T 7: 65,319,253 D699E probably damaging Het
Tmem143 A G 7: 45,916,564 D437G possibly damaging Het
Tmem45a2 A G 16: 57,047,084 Y85H possibly damaging Het
Tmem45b T A 9: 31,429,087 T7S probably damaging Het
Ube4b A G 4: 149,347,971 L832P probably damaging Het
Ugp2 G T 11: 21,329,048 F379L probably damaging Het
Ugt3a2 A T 15: 9,365,351 D350V probably damaging Het
Vmn2r8 T A 5: 108,802,418 T188S possibly damaging Het
Vwa7 C G 17: 35,017,112 P14R probably benign Het
Vwc2 C A 11: 11,261,495 T317K probably damaging Het
Vwf A T 6: 125,628,372 Q906L probably benign Het
Wdr49 A G 3: 75,429,347 V351A probably damaging Het
Wdr7 A G 18: 63,728,504 S196G probably benign Het
Xkr6 C A 14: 63,798,296 A26E unknown Het
Zcchc11 T A 4: 108,550,725 V1397D probably damaging Het
Zfp955b T C 17: 33,305,453 I47V probably benign Het
Other mutations in Akap11
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00672:Akap11 APN 14 78511341 missense probably damaging 1.00
IGL00902:Akap11 APN 14 78495838 missense probably benign 0.11
IGL01752:Akap11 APN 14 78509878 critical splice donor site probably null
IGL01972:Akap11 APN 14 78507857 missense probably damaging 0.99
IGL02031:Akap11 APN 14 78513813 missense possibly damaging 0.50
IGL02239:Akap11 APN 14 78513849 missense probably damaging 1.00
IGL02528:Akap11 APN 14 78510867 missense probably damaging 1.00
IGL02884:Akap11 APN 14 78498962 missense probably benign 0.02
IGL03130:Akap11 APN 14 78510368 nonsense probably null
IGL03179:Akap11 APN 14 78507740 missense probably benign 0.00
IGL03240:Akap11 APN 14 78495905 missense probably damaging 0.99
IGL03331:Akap11 APN 14 78513865 missense probably damaging 1.00
bonham UTSW 14 78498864 nonsense probably null
R0004:Akap11 UTSW 14 78514940 missense possibly damaging 0.65
R0020:Akap11 UTSW 14 78518177 missense probably benign 0.37
R0200:Akap11 UTSW 14 78510753 missense probably benign 0.00
R0281:Akap11 UTSW 14 78510089 missense possibly damaging 0.84
R0320:Akap11 UTSW 14 78513379 missense probably benign
R0381:Akap11 UTSW 14 78513550 missense probably benign 0.01
R0536:Akap11 UTSW 14 78514024 missense probably damaging 1.00
R0608:Akap11 UTSW 14 78510753 missense probably benign 0.00
R0735:Akap11 UTSW 14 78510078 missense probably damaging 1.00
R1189:Akap11 UTSW 14 78513347 missense probably benign 0.11
R1400:Akap11 UTSW 14 78513962 missense probably damaging 1.00
R1406:Akap11 UTSW 14 78512749 missense probably benign
R1406:Akap11 UTSW 14 78512749 missense probably benign
R1501:Akap11 UTSW 14 78513347 missense probably benign 0.11
R1588:Akap11 UTSW 14 78510245 missense possibly damaging 0.50
R1717:Akap11 UTSW 14 78513348 missense probably benign 0.02
R1823:Akap11 UTSW 14 78511488 missense probably damaging 1.00
R1847:Akap11 UTSW 14 78513661 missense probably benign 0.00
R2031:Akap11 UTSW 14 78510037 missense possibly damaging 0.86
R2032:Akap11 UTSW 14 78510037 missense possibly damaging 0.86
R2276:Akap11 UTSW 14 78510037 missense possibly damaging 0.86
R2763:Akap11 UTSW 14 78518892 missense probably damaging 0.98
R4483:Akap11 UTSW 14 78510259 missense probably damaging 1.00
R4582:Akap11 UTSW 14 78511929 missense possibly damaging 0.81
R4857:Akap11 UTSW 14 78498860 missense
R4922:Akap11 UTSW 14 78512780 nonsense probably null
R4993:Akap11 UTSW 14 78512968 missense probably damaging 1.00
R5426:Akap11 UTSW 14 78498864 nonsense probably null
R5472:Akap11 UTSW 14 78513429 missense probably benign 0.03
R5683:Akap11 UTSW 14 78512578 missense probably damaging 0.98
R5774:Akap11 UTSW 14 78510967 missense probably damaging 1.00
R6014:Akap11 UTSW 14 78512499 missense probably benign 0.00
R6264:Akap11 UTSW 14 78512421 missense possibly damaging 0.68
R6270:Akap11 UTSW 14 78518799 missense probably damaging 1.00
R6319:Akap11 UTSW 14 78513538 missense probably benign 0.06
R6376:Akap11 UTSW 14 78514896 missense probably damaging 1.00
R6394:Akap11 UTSW 14 78522589 critical splice donor site probably null
R6536:Akap11 UTSW 14 78511314 missense possibly damaging 0.81
R7048:Akap11 UTSW 14 78512514 missense
R7147:Akap11 UTSW 14 78511465 missense
R7473:Akap11 UTSW 14 78513888 missense
R7503:Akap11 UTSW 14 78512001 missense
R7542:Akap11 UTSW 14 78510292 missense
R7618:Akap11 UTSW 14 78498860 missense
R7679:Akap11 UTSW 14 78514816 missense
R7973:Akap11 UTSW 14 78515066 missense
R8094:Akap11 UTSW 14 78512973 missense
R8098:Akap11 UTSW 14 78512922 missense
R8226:Akap11 UTSW 14 78511209 missense
R8269:Akap11 UTSW 14 78513378 missense
R8304:Akap11 UTSW 14 78513232 missense
R8343:Akap11 UTSW 14 78512489 missense
R8389:Akap11 UTSW 14 78518882 missense
R8824:Akap11 UTSW 14 78516347 missense
R9034:Akap11 UTSW 14 78510859 missense
R9189:Akap11 UTSW 14 78513498 missense
R9259:Akap11 UTSW 14 78512509 missense
R9275:Akap11 UTSW 14 78513709 missense
R9434:Akap11 UTSW 14 78510389 missense
R9500:Akap11 UTSW 14 78511103 missense
Predicted Primers PCR Primer

Sequencing Primer
Posted On 2014-06-30