Mutagenetix > Incidental Mutation

Incidental Mutation 'R0139:Nup133'

22187

Institutional Source

Beutler Lab

Gene Symbol

Nup133

Ensembl Gene

ENSMUSG00000039509

Gene Name

nucleoporin 133

Synonyms

mermaid, 4832420O05Rik

MMRRC Submission

038424-MU

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R0139 (G1)

Quality Score

225

Status

Validated (trace)

Chromosome

Chromosomal Location

123897123-123949265 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 123929343 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Asparagine to Lysine at position 466 (N466K)

Ref Sequence

ENSEMBL: ENSMUSP00000048084 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000044795] [ENSMUST00000127664]

AlphaFold

Q8R0G9

Predicted Effect

probably benign
Transcript: ENSMUST00000044795
AA Change: N466K

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)

SMART Domains

Protein: ENSMUSP00000048084
Gene: ENSMUSG00000039509
AA Change: N466K

Domain	Start	End	E-Value	Type
low complexity region	8	19	N/A	INTRINSIC
PDB:1XKS\|A	66	513	N/A	PDB
Pfam:Nucleoporin_C	593	1052	1.2e-26	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000127664

SMART Domains

Protein: ENSMUSP00000118564
Gene: ENSMUSG00000092329

Domain	Start	End	E-Value	Type
Pfam:Glycos_transf_2	104	287	7.4e-31	PFAM
Pfam:Glyco_transf_7C	261	331	4.9e-8	PFAM
RICIN	406	531	9.28e-27	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000212133

Meta Mutation Damage Score

0.0898

Coding Region Coverage

1x: 99.0%
3x: 98.1%
10x: 95.9%
20x: 91.2%

Validation Efficiency

97% (89/92)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The nuclear envelope creates distinct nuclear and cytoplasmic compartments in eukaryotic cells. It consists of two concentric membranes perforated by nuclear pores, large protein complexes that form aqueous channels to regulate the flow of macromolecules between the nucleus and the cytoplasm. These complexes are composed of at least 100 different polypeptide subunits, many of which belong to the nucleoporin family. The nucleoporin protein encoded by this gene displays evolutionarily conserved interactions with other nucleoporins. This protein, which localizes to both sides of the nuclear pore complex at interphase, remains associated with the complex during mitosis and is targeted at early stages to the reforming nuclear envelope. This protein also localizes to kinetochores of mitotic cells. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for an ENU-induced allele exhibit embryonic lethality prior to E10.5, abnormal somitogenesis, pericardial edema, growth retardation, and abnormal neural development. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 87 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
0610010F05Rik	A	T	11: 23,620,214		probably benign	Het
2010111I01Rik	A	G	13: 63,190,484	N558S	probably benign	Het
A230072I06Rik	C	T	8: 12,279,899	S118L	unknown	Het
Adprhl2	A	G	4: 126,318,154	Y122H	probably damaging	Het
Ankrd52	T	C	10: 128,386,138	S544P	probably benign	Het
Arhgef7	A	G	8: 11,800,503	E111G	probably damaging	Het
Atp11a	A	G	8: 12,846,054	M755V	probably benign	Het
Atp2a2	A	G	5: 122,491,715	I97T	probably damaging	Het
Bmp3	G	A	5: 98,879,909	D463N	possibly damaging	Het
Cacna2d4	T	C	6: 119,278,269		probably benign	Het
Ccdc28a	G	A	10: 18,230,440	S46F	possibly damaging	Het
Ccdc36	T	C	9: 108,412,496	T176A	probably damaging	Het
Ccdc40	G	A	11: 119,264,299	G1122S	probably benign	Het
Cenpw	T	G	10: 30,200,459	T8P	probably benign	Het
Cfap44	G	C	16: 44,433,422	G893R	possibly damaging	Het
Cops7a	A	T	6: 124,961,360	C110S	probably damaging	Het
Cstl1	A	G	2: 148,755,325	N134S	probably damaging	Het
Cyp2s1	G	T	7: 25,811,689		probably null	Het
Dio2	T	A	12: 90,729,843	N124Y	probably damaging	Het
Ecel1	C	A	1: 87,154,526	G155V	possibly damaging	Het
Efr3a	G	T	15: 65,845,981	V337F	possibly damaging	Het
Eva1b	A	C	4: 126,149,653	H162P	probably damaging	Het
Exoc5	C	T	14: 49,036,036	E301K	probably damaging	Het
F13b	G	A	1: 139,508,203	S249N	probably damaging	Het
Fam120b	C	T	17: 15,426,184		probably benign	Het
Gbf1	T	C	19: 46,261,792	L396S	probably damaging	Het
Gck	T	A	11: 5,909,139	K143*	probably null	Het
Gck	C	A	11: 5,910,370	V91L	probably damaging	Het
Glt8d2	T	C	10: 82,660,810	N138S	probably damaging	Het
Gm17359	A	T	3: 79,405,835	Y72F	probably damaging	Het
Gm4884	T	C	7: 41,042,963	F119L	probably benign	Het
Igsf11	T	C	16: 39,008,878	S45P	probably damaging	Het
Il10	G	A	1: 131,022,534	V142M	probably damaging	Het
Insc	A	T	7: 114,769,002	H9L	probably damaging	Het
Iqsec1	G	T	6: 90,809,758		probably benign	Het
Katnb1	A	G	8: 95,098,422	S611G	possibly damaging	Het
Kcnb1	A	G	2: 167,105,539	I463T	possibly damaging	Het
Lao1	A	G	4: 118,964,202	N90S	probably benign	Het
Med16	T	A	10: 79,896,801	M710L	probably benign	Het
Mroh2a	G	C	1: 88,257,802	E1510D	probably damaging	Het
Mtus1	G	A	8: 41,016,196		probably benign	Het
Mybpc3	A	G	2: 91,120,337		probably benign	Het
Ndor1	C	T	2: 25,248,354	V405M	possibly damaging	Het
Nell2	A	G	15: 95,432,901	V213A	probably benign	Het
Nme8	T	C	13: 19,677,848	I204V	probably benign	Het
Nxt1	A	G	2: 148,675,470	T44A	probably benign	Het
Olfr1303	A	T	2: 111,814,354	I124K	possibly damaging	Het
Olfr1382	C	T	11: 49,535,574	L130F	probably benign	Het
Olfr1508	T	C	14: 52,463,212	T239A	probably damaging	Het
Olfr310	T	C	7: 86,268,979	E270G	probably benign	Het
Olfr697	A	T	7: 106,741,625	I103N	probably benign	Het
Olfr859	C	T	9: 19,808,869	L184F	probably damaging	Het
Pced1a	T	C	2: 130,421,907	K275R	probably benign	Het
Pdcd11	A	G	19: 47,110,959		probably null	Het
Phldb2	A	C	16: 45,770,666		probably benign	Het
Pifo	A	T	3: 105,999,570	M171K	possibly damaging	Het
Piwil1	C	A	5: 128,747,323	S490Y	probably damaging	Het
Plekhh3	T	C	11: 101,163,675		probably benign	Het
Ppargc1b	A	T	18: 61,315,963		probably benign	Het
Psg19	C	T	7: 18,797,017	V71I	possibly damaging	Het
Ptk6	T	C	2: 181,196,931		probably benign	Het
Pus7	A	G	5: 23,778,092	S126P	probably damaging	Het
Rab6b	T	A	9: 103,140,377		probably null	Het
Ranbp3	G	A	17: 56,709,272	R347Q	possibly damaging	Het
Sbf1	A	T	15: 89,302,498	L866Q	probably damaging	Het
Slc25a34	A	G	4: 141,622,352	V164A	possibly damaging	Het
Smg1	A	G	7: 118,152,675		probably null	Het
Spin1	G	T	13: 51,149,012	V214L	probably benign	Het
Sptbn1	T	C	11: 30,142,289	N492S	probably benign	Het
Stk-ps2	A	G	1: 46,029,795		noncoding transcript	Het
Taar7f	T	C	10: 24,050,414	I302T	probably benign	Het
Tdrd1	C	A	19: 56,843,198	H340Q	probably benign	Het
Thumpd3	A	G	6: 113,067,801	D498G	probably benign	Het
Tpgs2	A	G	18: 25,149,185	L103P	probably damaging	Het
Trip10	A	G	17: 57,261,633		probably null	Het
Trip6	A	T	5: 137,312,174	H269Q	probably benign	Het
Trmt12	T	C	15: 58,872,894	V47A	possibly damaging	Het
Trpm7	A	T	2: 126,812,771	S1416T	probably benign	Het
Tsks	G	A	7: 44,954,459	A438T	probably benign	Het
Ttn	T	C	2: 76,897,286		probably benign	Het
Twf2	G	A	9: 106,212,956	V136M	possibly damaging	Het
Uty	A	C	Y: 1,197,223	Y115D	probably damaging	Het
Vcan	A	G	13: 89,691,261	S2055P	probably damaging	Het
Yes1	A	G	5: 32,684,695	Q521R	possibly damaging	Het
Zfp114	A	T	7: 24,181,260	T344S	possibly damaging	Het
Zfp661	A	T	2: 127,578,612	V89D	possibly damaging	Het
Zfp91	A	T	19: 12,770,470	Y430N	probably damaging	Het

Other mutations in Nup133

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00470:Nup133	APN	8	123939083	missense	probably damaging	0.98
IGL00507:Nup133	APN	8	123918967	nonsense	probably null
IGL00585:Nup133	APN	8	123909994	missense	probably damaging	1.00
IGL00676:Nup133	APN	8	123906298	intron	probably benign
IGL00966:Nup133	APN	8	123911906	missense	probably damaging	0.98
IGL01069:Nup133	APN	8	123930982	nonsense	probably null
IGL01553:Nup133	APN	8	123915324	missense	possibly damaging	0.58
IGL01669:Nup133	APN	8	123939130	nonsense	probably null
IGL01730:Nup133	APN	8	123938233	missense	probably benign	0.00
IGL01996:Nup133	APN	8	123946595	missense	probably benign	0.00
IGL02332:Nup133	APN	8	123907832	missense	probably damaging	1.00
IGL02552:Nup133	APN	8	123929255	missense	possibly damaging	0.75
IGL02956:Nup133	APN	8	123949083	missense	probably benign	0.00
IGL03009:Nup133	APN	8	123933500	missense	possibly damaging	0.46
IGL03036:Nup133	APN	8	123946594	missense	probably benign	0.11
Cadenza	UTSW	8	123911888	frame shift	probably null
Gangen	UTSW	8	123916282	critical splice donor site	probably null
hochzeit	UTSW	8	123929343	missense	probably benign	0.00
low_road	UTSW	8	123904579	missense	probably damaging	1.00
Pathway	UTSW	8	123917446	missense	possibly damaging	0.82
Slant	UTSW	8	123916281	splice site	probably null
R0010:Nup133	UTSW	8	123904579	missense	probably damaging	1.00
R0010:Nup133	UTSW	8	123904579	missense	probably damaging	1.00
R0344:Nup133	UTSW	8	123917446	missense	possibly damaging	0.82
R0730:Nup133	UTSW	8	123949008	missense	probably benign	0.00
R1301:Nup133	UTSW	8	123917417	intron	probably benign
R1453:Nup133	UTSW	8	123915375	missense	probably benign	0.00
R1570:Nup133	UTSW	8	123949176	start codon destroyed	possibly damaging	0.82
R1607:Nup133	UTSW	8	123949035	missense	probably benign	0.02
R1773:Nup133	UTSW	8	123930983	nonsense	probably null
R1992:Nup133	UTSW	8	123906221	missense	possibly damaging	0.80
R2062:Nup133	UTSW	8	123914575	missense	probably damaging	1.00
R2065:Nup133	UTSW	8	123914575	missense	probably damaging	1.00
R2066:Nup133	UTSW	8	123914575	missense	probably damaging	1.00
R2068:Nup133	UTSW	8	123914575	missense	probably damaging	1.00
R4397:Nup133	UTSW	8	123944301	missense	probably benign	0.04
R4683:Nup133	UTSW	8	123930982	nonsense	probably null
R4771:Nup133	UTSW	8	123929398	missense	probably damaging	1.00
R4910:Nup133	UTSW	8	123927131	missense	possibly damaging	0.91
R4911:Nup133	UTSW	8	123927131	missense	possibly damaging	0.91
R4968:Nup133	UTSW	8	123915196	missense	probably benign	0.07
R5411:Nup133	UTSW	8	123927206	missense	probably benign
R5470:Nup133	UTSW	8	123930966	missense	probably benign	0.00
R5664:Nup133	UTSW	8	123906281	missense	probably benign	0.01
R5907:Nup133	UTSW	8	123916299	missense	possibly damaging	0.90
R6003:Nup133	UTSW	8	123938292	missense	probably damaging	0.98
R6059:Nup133	UTSW	8	123914596	missense	probably damaging	1.00
R6219:Nup133	UTSW	8	123936873	missense	possibly damaging	0.90
R6292:Nup133	UTSW	8	123917437	missense	probably benign	0.01
R6672:Nup133	UTSW	8	123916281	splice site	probably null
R6737:Nup133	UTSW	8	123906291	missense	probably damaging	0.99
R6763:Nup133	UTSW	8	123944278	missense	possibly damaging	0.95
R6870:Nup133	UTSW	8	123899507	missense	probably benign	0.08
R6975:Nup133	UTSW	8	123915318	missense	probably damaging	0.99
R7101:Nup133	UTSW	8	123906227	missense	possibly damaging	0.89
R7114:Nup133	UTSW	8	123915373	missense	probably benign	0.00
R7271:Nup133	UTSW	8	123922414	missense	probably benign	0.34
R7501:Nup133	UTSW	8	123922414	missense	probably benign	0.34
R8054:Nup133	UTSW	8	123949217	intron	probably benign
R8397:Nup133	UTSW	8	123922417	missense	probably benign	0.17
R8703:Nup133	UTSW	8	123916282	critical splice donor site	probably null
R8811:Nup133	UTSW	8	123911888	frame shift	probably null
R8813:Nup133	UTSW	8	123911888	frame shift	probably null
R8952:Nup133	UTSW	8	123907761	missense	probably damaging	1.00
R9116:Nup133	UTSW	8	123933416	missense	probably benign	0.00
R9340:Nup133	UTSW	8	123938142	missense	probably benign	0.38
X0023:Nup133	UTSW	8	123909988	missense	probably benign

Predicted Primers

PCR Primer
(F):5'- TGTATGTGATGCCACAAGTGCCC -3'
(R):5'- AAGTGGAAAGGCCGTCTGCTTC -3'

Sequencing Primer
(F):5'- GAAGCATGAATTGTCCCAAGTC -3'
(R):5'- TGCTTCATGGAGTAGGAGCA -3'

Posted On

2013-04-16