Incidental Mutation 'R0139:Nup133'
ID22187
Institutional Source Beutler Lab
Gene Symbol Nup133
Ensembl Gene ENSMUSG00000039509
Gene Namenucleoporin 133
Synonymsmermaid, 4832420O05Rik
MMRRC Submission 038424-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0139 (G1)
Quality Score225
Status Validated (trace)
Chromosome8
Chromosomal Location123897123-123949265 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 123929343 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Lysine at position 466 (N466K)
Ref Sequence ENSEMBL: ENSMUSP00000048084 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000044795] [ENSMUST00000127664]
Predicted Effect probably benign
Transcript: ENSMUST00000044795
AA Change: N466K

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000048084
Gene: ENSMUSG00000039509
AA Change: N466K

DomainStartEndE-ValueType
low complexity region 8 19 N/A INTRINSIC
PDB:1XKS|A 66 513 N/A PDB
Pfam:Nucleoporin_C 593 1052 1.2e-26 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000127664
SMART Domains Protein: ENSMUSP00000118564
Gene: ENSMUSG00000092329

DomainStartEndE-ValueType
Pfam:Glycos_transf_2 104 287 7.4e-31 PFAM
Pfam:Glyco_transf_7C 261 331 4.9e-8 PFAM
RICIN 406 531 9.28e-27 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000212133
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.1%
  • 10x: 95.9%
  • 20x: 91.2%
Validation Efficiency 97% (89/92)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The nuclear envelope creates distinct nuclear and cytoplasmic compartments in eukaryotic cells. It consists of two concentric membranes perforated by nuclear pores, large protein complexes that form aqueous channels to regulate the flow of macromolecules between the nucleus and the cytoplasm. These complexes are composed of at least 100 different polypeptide subunits, many of which belong to the nucleoporin family. The nucleoporin protein encoded by this gene displays evolutionarily conserved interactions with other nucleoporins. This protein, which localizes to both sides of the nuclear pore complex at interphase, remains associated with the complex during mitosis and is targeted at early stages to the reforming nuclear envelope. This protein also localizes to kinetochores of mitotic cells. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for an ENU-induced allele exhibit embryonic lethality prior to E10.5, abnormal somitogenesis, pericardial edema, growth retardation, and abnormal neural development. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 87 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610010F05Rik A T 11: 23,620,214 probably benign Het
2010111I01Rik A G 13: 63,190,484 N558S probably benign Het
A230072I06Rik C T 8: 12,279,899 S118L unknown Het
Adprhl2 A G 4: 126,318,154 Y122H probably damaging Het
Ankrd52 T C 10: 128,386,138 S544P probably benign Het
Arhgef7 A G 8: 11,800,503 E111G probably damaging Het
Atp11a A G 8: 12,846,054 M755V probably benign Het
Atp2a2 A G 5: 122,491,715 I97T probably damaging Het
Bmp3 G A 5: 98,879,909 D463N possibly damaging Het
Cacna2d4 T C 6: 119,278,269 probably benign Het
Ccdc28a G A 10: 18,230,440 S46F possibly damaging Het
Ccdc36 T C 9: 108,412,496 T176A probably damaging Het
Ccdc40 G A 11: 119,264,299 G1122S probably benign Het
Cenpw T G 10: 30,200,459 T8P probably benign Het
Cfap44 G C 16: 44,433,422 G893R possibly damaging Het
Cops7a A T 6: 124,961,360 C110S probably damaging Het
Cstl1 A G 2: 148,755,325 N134S probably damaging Het
Cyp2s1 G T 7: 25,811,689 probably null Het
Dio2 T A 12: 90,729,843 N124Y probably damaging Het
Ecel1 C A 1: 87,154,526 G155V possibly damaging Het
Efr3a G T 15: 65,845,981 V337F possibly damaging Het
Eva1b A C 4: 126,149,653 H162P probably damaging Het
Exoc5 C T 14: 49,036,036 E301K probably damaging Het
F13b G A 1: 139,508,203 S249N probably damaging Het
Fam120b C T 17: 15,426,184 probably benign Het
Gbf1 T C 19: 46,261,792 L396S probably damaging Het
Gck T A 11: 5,909,139 K143* probably null Het
Gck C A 11: 5,910,370 V91L probably damaging Het
Glt8d2 T C 10: 82,660,810 N138S probably damaging Het
Gm17359 A T 3: 79,405,835 Y72F probably damaging Het
Gm4884 T C 7: 41,042,963 F119L probably benign Het
Igsf11 T C 16: 39,008,878 S45P probably damaging Het
Il10 G A 1: 131,022,534 V142M probably damaging Het
Insc A T 7: 114,769,002 H9L probably damaging Het
Iqsec1 G T 6: 90,809,758 probably benign Het
Katnb1 A G 8: 95,098,422 S611G possibly damaging Het
Kcnb1 A G 2: 167,105,539 I463T possibly damaging Het
Lao1 A G 4: 118,964,202 N90S probably benign Het
Med16 T A 10: 79,896,801 M710L probably benign Het
Mroh2a G C 1: 88,257,802 E1510D probably damaging Het
Mtus1 G A 8: 41,016,196 probably benign Het
Mybpc3 A G 2: 91,120,337 probably benign Het
Ndor1 C T 2: 25,248,354 V405M possibly damaging Het
Nell2 A G 15: 95,432,901 V213A probably benign Het
Nme8 T C 13: 19,677,848 I204V probably benign Het
Nxt1 A G 2: 148,675,470 T44A probably benign Het
Olfr1303 A T 2: 111,814,354 I124K possibly damaging Het
Olfr1382 C T 11: 49,535,574 L130F probably benign Het
Olfr1508 T C 14: 52,463,212 T239A probably damaging Het
Olfr310 T C 7: 86,268,979 E270G probably benign Het
Olfr697 A T 7: 106,741,625 I103N probably benign Het
Olfr859 C T 9: 19,808,869 L184F probably damaging Het
Pced1a T C 2: 130,421,907 K275R probably benign Het
Pdcd11 A G 19: 47,110,959 probably null Het
Phldb2 A C 16: 45,770,666 probably benign Het
Pifo A T 3: 105,999,570 M171K possibly damaging Het
Piwil1 C A 5: 128,747,323 S490Y probably damaging Het
Plekhh3 T C 11: 101,163,675 probably benign Het
Ppargc1b A T 18: 61,315,963 probably benign Het
Psg19 C T 7: 18,797,017 V71I possibly damaging Het
Ptk6 T C 2: 181,196,931 probably benign Het
Pus7 A G 5: 23,778,092 S126P probably damaging Het
Rab6b T A 9: 103,140,377 probably null Het
Ranbp3 G A 17: 56,709,272 R347Q possibly damaging Het
Sbf1 A T 15: 89,302,498 L866Q probably damaging Het
Slc25a34 A G 4: 141,622,352 V164A possibly damaging Het
Smg1 A G 7: 118,152,675 probably null Het
Spin1 G T 13: 51,149,012 V214L probably benign Het
Sptbn1 T C 11: 30,142,289 N492S probably benign Het
Stk-ps2 A G 1: 46,029,795 noncoding transcript Het
Taar7f T C 10: 24,050,414 I302T probably benign Het
Tdrd1 C A 19: 56,843,198 H340Q probably benign Het
Thumpd3 A G 6: 113,067,801 D498G probably benign Het
Tpgs2 A G 18: 25,149,185 L103P probably damaging Het
Trip10 A G 17: 57,261,633 probably null Het
Trip6 A T 5: 137,312,174 H269Q probably benign Het
Trmt12 T C 15: 58,872,894 V47A possibly damaging Het
Trpm7 A T 2: 126,812,771 S1416T probably benign Het
Tsks G A 7: 44,954,459 A438T probably benign Het
Ttn T C 2: 76,897,286 probably benign Het
Twf2 G A 9: 106,212,956 V136M possibly damaging Het
Uty A C Y: 1,197,223 Y115D probably damaging Het
Vcan A G 13: 89,691,261 S2055P probably damaging Het
Yes1 A G 5: 32,684,695 Q521R possibly damaging Het
Zfp114 A T 7: 24,181,260 T344S possibly damaging Het
Zfp661 A T 2: 127,578,612 V89D possibly damaging Het
Zfp91 A T 19: 12,770,470 Y430N probably damaging Het
Other mutations in Nup133
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00470:Nup133 APN 8 123939083 missense probably damaging 0.98
IGL00507:Nup133 APN 8 123918967 nonsense probably null
IGL00585:Nup133 APN 8 123909994 missense probably damaging 1.00
IGL00676:Nup133 APN 8 123906298 intron probably benign
IGL00966:Nup133 APN 8 123911906 missense probably damaging 0.98
IGL01069:Nup133 APN 8 123930982 nonsense probably null
IGL01553:Nup133 APN 8 123915324 missense possibly damaging 0.58
IGL01669:Nup133 APN 8 123939130 nonsense probably null
IGL01730:Nup133 APN 8 123938233 missense probably benign 0.00
IGL01996:Nup133 APN 8 123946595 missense probably benign 0.00
IGL02332:Nup133 APN 8 123907832 missense probably damaging 1.00
IGL02552:Nup133 APN 8 123929255 missense possibly damaging 0.75
IGL02956:Nup133 APN 8 123949083 missense probably benign 0.00
IGL03009:Nup133 APN 8 123933500 missense possibly damaging 0.46
IGL03036:Nup133 APN 8 123946594 missense probably benign 0.11
Slant UTSW 8 123916281 splice site probably null
R0010:Nup133 UTSW 8 123904579 missense probably damaging 1.00
R0010:Nup133 UTSW 8 123904579 missense probably damaging 1.00
R0344:Nup133 UTSW 8 123917446 missense possibly damaging 0.82
R0730:Nup133 UTSW 8 123949008 missense probably benign 0.00
R1301:Nup133 UTSW 8 123917417 intron probably benign
R1453:Nup133 UTSW 8 123915375 missense probably benign 0.00
R1570:Nup133 UTSW 8 123949176 start codon destroyed possibly damaging 0.82
R1607:Nup133 UTSW 8 123949035 missense probably benign 0.02
R1773:Nup133 UTSW 8 123930983 nonsense probably null
R1992:Nup133 UTSW 8 123906221 missense possibly damaging 0.80
R2062:Nup133 UTSW 8 123914575 missense probably damaging 1.00
R2065:Nup133 UTSW 8 123914575 missense probably damaging 1.00
R2066:Nup133 UTSW 8 123914575 missense probably damaging 1.00
R2068:Nup133 UTSW 8 123914575 missense probably damaging 1.00
R4397:Nup133 UTSW 8 123944301 missense probably benign 0.04
R4683:Nup133 UTSW 8 123930982 nonsense probably null
R4771:Nup133 UTSW 8 123929398 missense probably damaging 1.00
R4910:Nup133 UTSW 8 123927131 missense possibly damaging 0.91
R4911:Nup133 UTSW 8 123927131 missense possibly damaging 0.91
R4968:Nup133 UTSW 8 123915196 missense probably benign 0.07
R5411:Nup133 UTSW 8 123927206 missense probably benign
R5470:Nup133 UTSW 8 123930966 missense probably benign 0.00
R5664:Nup133 UTSW 8 123906281 missense probably benign 0.01
R5907:Nup133 UTSW 8 123916299 missense possibly damaging 0.90
R6003:Nup133 UTSW 8 123938292 missense probably damaging 0.98
R6059:Nup133 UTSW 8 123914596 missense probably damaging 1.00
R6219:Nup133 UTSW 8 123936873 missense possibly damaging 0.90
R6292:Nup133 UTSW 8 123917437 missense probably benign 0.01
R6672:Nup133 UTSW 8 123916281 splice site probably null
R6737:Nup133 UTSW 8 123906291 missense probably damaging 0.99
R6763:Nup133 UTSW 8 123944278 missense possibly damaging 0.95
R6870:Nup133 UTSW 8 123899507 missense probably benign 0.08
R6975:Nup133 UTSW 8 123915318 missense probably damaging 0.99
R7101:Nup133 UTSW 8 123906227 missense possibly damaging 0.89
R7114:Nup133 UTSW 8 123915373 missense probably benign 0.00
R7271:Nup133 UTSW 8 123922414 missense probably benign 0.34
R7501:Nup133 UTSW 8 123922414 missense probably benign 0.34
R8054:Nup133 UTSW 8 123949217 intron probably benign
X0023:Nup133 UTSW 8 123909988 missense probably benign
Predicted Primers PCR Primer
(F):5'- TGTATGTGATGCCACAAGTGCCC -3'
(R):5'- AAGTGGAAAGGCCGTCTGCTTC -3'

Sequencing Primer
(F):5'- GAAGCATGAATTGTCCCAAGTC -3'
(R):5'- TGCTTCATGGAGTAGGAGCA -3'
Posted On2013-04-16