Incidental Mutation 'R8703:Nup133'
ID 669155
Institutional Source Beutler Lab
Gene Symbol Nup133
Ensembl Gene ENSMUSG00000039509
Gene Name nucleoporin 133
Synonyms mermaid, 4832420O05Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R8703 (G1)
Quality Score 225.009
Status Validated
Chromosome 8
Chromosomal Location 123897123-123949265 bp(-) (GRCm38)
Type of Mutation critical splice donor site (2 bp from exon)
DNA Base Change (assembly) A to G at 123916282 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000048084 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000044795] [ENSMUST00000044795] [ENSMUST00000044795] [ENSMUST00000127664]
AlphaFold Q8R0G9
Predicted Effect probably null
Transcript: ENSMUST00000044795
SMART Domains Protein: ENSMUSP00000048084
Gene: ENSMUSG00000039509

DomainStartEndE-ValueType
low complexity region 8 19 N/A INTRINSIC
PDB:1XKS|A 66 513 N/A PDB
Pfam:Nucleoporin_C 593 1052 1.2e-26 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000044795
SMART Domains Protein: ENSMUSP00000048084
Gene: ENSMUSG00000039509

DomainStartEndE-ValueType
low complexity region 8 19 N/A INTRINSIC
PDB:1XKS|A 66 513 N/A PDB
Pfam:Nucleoporin_C 593 1052 1.2e-26 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000044795
SMART Domains Protein: ENSMUSP00000048084
Gene: ENSMUSG00000039509

DomainStartEndE-ValueType
low complexity region 8 19 N/A INTRINSIC
PDB:1XKS|A 66 513 N/A PDB
Pfam:Nucleoporin_C 593 1052 1.2e-26 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000127664
SMART Domains Protein: ENSMUSP00000118564
Gene: ENSMUSG00000092329

DomainStartEndE-ValueType
Pfam:Glycos_transf_2 104 287 7.4e-31 PFAM
Pfam:Glyco_transf_7C 261 331 4.9e-8 PFAM
RICIN 406 531 9.28e-27 SMART
Meta Mutation Damage Score 0.9503 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency 100% (44/44)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The nuclear envelope creates distinct nuclear and cytoplasmic compartments in eukaryotic cells. It consists of two concentric membranes perforated by nuclear pores, large protein complexes that form aqueous channels to regulate the flow of macromolecules between the nucleus and the cytoplasm. These complexes are composed of at least 100 different polypeptide subunits, many of which belong to the nucleoporin family. The nucleoporin protein encoded by this gene displays evolutionarily conserved interactions with other nucleoporins. This protein, which localizes to both sides of the nuclear pore complex at interphase, remains associated with the complex during mitosis and is targeted at early stages to the reforming nuclear envelope. This protein also localizes to kinetochores of mitotic cells. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for an ENU-induced allele exhibit embryonic lethality prior to E10.5, abnormal somitogenesis, pericardial edema, growth retardation, and abnormal neural development. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrv1 G A 13: 81,528,673 T2013I probably damaging Het
Ak9 A T 10: 41,325,124 N137Y Het
Apol10b T A 15: 77,588,697 E52D probably damaging Het
Calr3 A T 8: 72,438,447 Y128N probably damaging Het
Dnah14 T A 1: 181,666,011 L1669* probably null Het
Dppa3 A T 6: 122,628,778 D97V probably damaging Het
Dync1li1 C A 9: 114,723,261 P490T probably damaging Het
Eya4 A G 10: 23,163,442 S85P probably benign Het
Fpr-rs4 T A 17: 18,022,070 I113N probably damaging Het
Fryl T C 5: 73,090,654 D1040G probably damaging Het
Fsip2 A T 2: 82,991,527 D5868V probably damaging Het
Gpr75 A C 11: 30,891,890 Q265P probably damaging Het
Iqcm G T 8: 75,888,643 G451C probably damaging Het
Lgr5 A G 10: 115,452,705 L678P probably benign Het
Mcm9 G A 10: 53,629,977 P67L probably damaging Het
Naalad2 A C 9: 18,378,712 Y207D probably damaging Het
Nrap C T 19: 56,335,271 D1325N probably damaging Het
Ogfr GGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGGGCCAGAGGACCCCCAAAGCCAGGTGG GGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGGGCCAGAGGACCCCCAAAGCCAGGTGG 2: 180,595,266 probably benign Het
Olfr1066 C A 2: 86,455,900 V124L possibly damaging Het
Olfr1272 T A 2: 90,296,493 I123F probably damaging Het
Olfr1499 G T 19: 13,814,741 P283H probably damaging Het
Per2 T A 1: 91,424,045 N913I possibly damaging Het
Rab9 C T X: 166,457,758 D186N probably benign Het
Reps1 C T 10: 18,093,242 R183C probably damaging Het
Rims1 A T 1: 22,425,887 C134S Het
Rpl10-ps3 A G 9: 50,344,884 S20P probably benign Het
Sash1 C A 10: 8,729,831 G932C probably damaging Het
Sema4d T C 13: 51,700,923 Q46R Het
Sh3d19 A G 3: 86,107,261 E453G probably damaging Het
Sirt6 A G 10: 81,625,714 probably benign Het
Sis A T 3: 72,960,324 F129L probably damaging Het
Skint5 T A 4: 113,876,010 I399F unknown Het
Slc22a7 T C 17: 46,434,025 D365G probably damaging Het
Slc6a12 A G 6: 121,347,488 M38V probably benign Het
Slc9b2 C A 3: 135,326,163 Y261* probably null Het
Spata21 A G 4: 141,104,907 I460V probably benign Het
Tes C G 6: 17,099,789 P261R probably damaging Het
Tex15 T C 8: 33,572,696 L718P probably benign Het
Tmem135 G A 7: 89,158,962 A202V probably benign Het
Usp29 T C 7: 6,961,322 F55L probably benign Het
Usp9y A G Y: 1,356,317 L1128P probably damaging Het
Zdhhc5 T C 2: 84,690,252 E527G probably benign Het
Zfand4 A G 6: 116,273,643 I11M probably damaging Het
Zfp110 T A 7: 12,848,961 I512K probably benign Het
Zfp638 T A 6: 83,977,161 F1416Y probably damaging Het
Other mutations in Nup133
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00470:Nup133 APN 8 123939083 missense probably damaging 0.98
IGL00507:Nup133 APN 8 123918967 nonsense probably null
IGL00585:Nup133 APN 8 123909994 missense probably damaging 1.00
IGL00676:Nup133 APN 8 123906298 intron probably benign
IGL00966:Nup133 APN 8 123911906 missense probably damaging 0.98
IGL01069:Nup133 APN 8 123930982 nonsense probably null
IGL01553:Nup133 APN 8 123915324 missense possibly damaging 0.58
IGL01669:Nup133 APN 8 123939130 nonsense probably null
IGL01730:Nup133 APN 8 123938233 missense probably benign 0.00
IGL01996:Nup133 APN 8 123946595 missense probably benign 0.00
IGL02332:Nup133 APN 8 123907832 missense probably damaging 1.00
IGL02552:Nup133 APN 8 123929255 missense possibly damaging 0.75
IGL02956:Nup133 APN 8 123949083 missense probably benign 0.00
IGL03009:Nup133 APN 8 123933500 missense possibly damaging 0.46
IGL03036:Nup133 APN 8 123946594 missense probably benign 0.11
Cadenza UTSW 8 123911888 frame shift probably null
Gangen UTSW 8 123916282 critical splice donor site probably null
hochzeit UTSW 8 123929343 missense probably benign 0.00
low_road UTSW 8 123904579 missense probably damaging 1.00
Pathway UTSW 8 123917446 missense possibly damaging 0.82
Slant UTSW 8 123916281 splice site probably null
R0010:Nup133 UTSW 8 123904579 missense probably damaging 1.00
R0010:Nup133 UTSW 8 123904579 missense probably damaging 1.00
R0139:Nup133 UTSW 8 123929343 missense probably benign 0.00
R0344:Nup133 UTSW 8 123917446 missense possibly damaging 0.82
R0730:Nup133 UTSW 8 123949008 missense probably benign 0.00
R1301:Nup133 UTSW 8 123917417 intron probably benign
R1453:Nup133 UTSW 8 123915375 missense probably benign 0.00
R1570:Nup133 UTSW 8 123949176 start codon destroyed possibly damaging 0.82
R1607:Nup133 UTSW 8 123949035 missense probably benign 0.02
R1773:Nup133 UTSW 8 123930983 nonsense probably null
R1992:Nup133 UTSW 8 123906221 missense possibly damaging 0.80
R2062:Nup133 UTSW 8 123914575 missense probably damaging 1.00
R2065:Nup133 UTSW 8 123914575 missense probably damaging 1.00
R2066:Nup133 UTSW 8 123914575 missense probably damaging 1.00
R2068:Nup133 UTSW 8 123914575 missense probably damaging 1.00
R4397:Nup133 UTSW 8 123944301 missense probably benign 0.04
R4683:Nup133 UTSW 8 123930982 nonsense probably null
R4771:Nup133 UTSW 8 123929398 missense probably damaging 1.00
R4910:Nup133 UTSW 8 123927131 missense possibly damaging 0.91
R4911:Nup133 UTSW 8 123927131 missense possibly damaging 0.91
R4968:Nup133 UTSW 8 123915196 missense probably benign 0.07
R5411:Nup133 UTSW 8 123927206 missense probably benign
R5470:Nup133 UTSW 8 123930966 missense probably benign 0.00
R5664:Nup133 UTSW 8 123906281 missense probably benign 0.01
R5907:Nup133 UTSW 8 123916299 missense possibly damaging 0.90
R6003:Nup133 UTSW 8 123938292 missense probably damaging 0.98
R6059:Nup133 UTSW 8 123914596 missense probably damaging 1.00
R6219:Nup133 UTSW 8 123936873 missense possibly damaging 0.90
R6292:Nup133 UTSW 8 123917437 missense probably benign 0.01
R6672:Nup133 UTSW 8 123916281 splice site probably null
R6737:Nup133 UTSW 8 123906291 missense probably damaging 0.99
R6763:Nup133 UTSW 8 123944278 missense possibly damaging 0.95
R6870:Nup133 UTSW 8 123899507 missense probably benign 0.08
R6975:Nup133 UTSW 8 123915318 missense probably damaging 0.99
R7101:Nup133 UTSW 8 123906227 missense possibly damaging 0.89
R7114:Nup133 UTSW 8 123915373 missense probably benign 0.00
R7271:Nup133 UTSW 8 123922414 missense probably benign 0.34
R7501:Nup133 UTSW 8 123922414 missense probably benign 0.34
R8054:Nup133 UTSW 8 123949217 intron probably benign
R8397:Nup133 UTSW 8 123922417 missense probably benign 0.17
R8811:Nup133 UTSW 8 123911888 frame shift probably null
R8813:Nup133 UTSW 8 123911888 frame shift probably null
R8952:Nup133 UTSW 8 123907761 missense probably damaging 1.00
R9116:Nup133 UTSW 8 123933416 missense probably benign 0.00
R9340:Nup133 UTSW 8 123938142 missense probably benign 0.38
X0023:Nup133 UTSW 8 123909988 missense probably benign
Predicted Primers PCR Primer
(F):5'- CTGGCAGGTGCATCATAAGTC -3'
(R):5'- CCCTTAGGCACAGTGTATGAC -3'

Sequencing Primer
(F):5'- ATCTCTGAGATTGAGGCCAGC -3'
(R):5'- CCTTAGGCACAGTGTATGACAGAAAG -3'
Posted On 2021-04-30