Incidental Mutation 'R2080:Zfp598'
ID229445
Institutional Source Beutler Lab
Gene Symbol Zfp598
Ensembl Gene ENSMUSG00000041130
Gene Namezinc finger protein 598
Synonyms
MMRRC Submission 040085-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.970) question?
Stock #R2080 (G1)
Quality Score225
Status Validated
Chromosome17
Chromosomal Location24669752-24682015 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 24679667 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Alanine at position 480 (D480A)
Ref Sequence ENSEMBL: ENSMUSP00000038367 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000047179]
Predicted Effect probably damaging
Transcript: ENSMUST00000047179
AA Change: D480A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000038367
Gene: ENSMUSG00000041130
AA Change: D480A

DomainStartEndE-ValueType
low complexity region 2 23 N/A INTRINSIC
RING 27 66 4.73e-1 SMART
ZnF_C2H2 115 140 9.46e0 SMART
low complexity region 144 153 N/A INTRINSIC
ZnF_C2H2 185 208 5.2e0 SMART
ZnF_C2H2 209 237 7.11e0 SMART
ZnF_C2H2 238 268 6.47e1 SMART
low complexity region 311 331 N/A INTRINSIC
low complexity region 344 356 N/A INTRINSIC
low complexity region 371 385 N/A INTRINSIC
low complexity region 445 454 N/A INTRINSIC
low complexity region 482 501 N/A INTRINSIC
low complexity region 526 544 N/A INTRINSIC
low complexity region 581 589 N/A INTRINSIC
low complexity region 645 663 N/A INTRINSIC
low complexity region 668 683 N/A INTRINSIC
low complexity region 694 748 N/A INTRINSIC
ZnF_C2H2 869 890 8.84e1 SMART
Meta Mutation Damage Score 0.3213 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.2%
  • 20x: 94.7%
Validation Efficiency 100% (55/55)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Zinc-finger proteins bind nucleic acids and play important roles in various cellular functions, including cell proliferation, differentiation, and apoptosis. This protein and Grb10-interacting GYF protein 2 have been identified as a components of the mammalian 4EHP (m4EHP) complex. The complex is thought to function as a translation repressor in embryonic development. [provided by RefSeq, Oct 2012]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310003L06Rik A T 5: 87,971,933 D183V probably damaging Het
Ambra1 T A 2: 91,885,719 D858E probably damaging Het
Amdhd2 T C 17: 24,156,604 T370A probably benign Het
Amy1 A G 3: 113,558,094 W449R probably benign Het
Aox3 A T 1: 58,186,280 I1179F probably benign Het
Atp10a C A 7: 58,824,327 Q1121K probably damaging Het
Btaf1 C T 19: 36,951,148 A123V probably benign Het
Car6 T C 4: 150,198,141 K16E probably benign Het
Cgnl1 C T 9: 71,656,096 D779N probably benign Het
Cyp2a4 G A 7: 26,308,537 R123Q possibly damaging Het
D430041D05Rik C T 2: 104,156,816 R1895Q probably damaging Het
D5Ertd579e T A 5: 36,616,206 T282S probably benign Het
Dsel T C 1: 111,859,962 T948A probably benign Het
Ednrb A T 14: 103,843,100 I126N probably damaging Het
Egln1 A G 8: 124,948,306 M250T probably benign Het
Epb41l3 A T 17: 69,253,468 I337L possibly damaging Het
Epg5 T C 18: 77,948,745 I219T probably benign Het
Gm13030 T C 4: 138,873,419 probably benign Het
Gm1527 T A 3: 28,926,661 C637S probably benign Het
Hist1h1a A G 13: 23,763,949 N78S possibly damaging Het
Insrr T C 3: 87,814,291 I1168T possibly damaging Het
Ireb2 T C 9: 54,896,552 V509A possibly damaging Het
Kmt2c T C 5: 25,354,717 D981G probably damaging Het
Ktn1 A G 14: 47,725,960 E1164G probably damaging Het
L3hypdh A T 12: 72,079,527 V213E probably damaging Het
Masp1 T G 16: 23,491,959 D241A probably damaging Het
Mfsd13b A G 7: 120,991,824 I1V probably null Het
Muc5b T C 7: 141,869,754 V4531A probably benign Het
Myh2 A T 11: 67,174,941 probably null Het
Naip5 A G 13: 100,221,533 L1065P probably damaging Het
Necab1 T C 4: 15,140,219 probably benign Het
Nemf A G 12: 69,353,786 probably benign Het
Nfil3 A T 13: 52,968,033 D278E possibly damaging Het
Nup98 T C 7: 102,180,424 N393S probably damaging Het
Ogdh T A 11: 6,349,393 M753K probably benign Het
Olfr11 A T 13: 21,639,436 V29E probably damaging Het
Olfr1297 C T 2: 111,621,739 V112M probably benign Het
Olfr273 T C 4: 52,855,568 Y315C probably benign Het
Olfr561 T C 7: 102,775,243 F240L probably benign Het
Olfr901 T A 9: 38,431,082 S267T probably benign Het
Pkd2 A G 5: 104,477,123 K262E probably benign Het
Plce1 C T 19: 38,727,013 probably benign Het
Ppm1f T A 16: 16,923,880 M406K possibly damaging Het
Ptgs1 C T 2: 36,242,847 Q286* probably null Het
Scube2 T C 7: 109,808,505 T743A possibly damaging Het
Tipin T A 9: 64,290,376 L69* probably null Het
Tlk1 T A 2: 70,738,445 K404N probably damaging Het
Tmem59 C A 4: 107,178,774 L16I probably damaging Het
Utrn T C 10: 12,737,082 E426G probably benign Het
Xdh A T 17: 73,909,325 S709T probably damaging Het
Yjefn3 T C 8: 69,889,487 N28D probably damaging Het
Other mutations in Zfp598
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01358:Zfp598 APN 17 24681424 unclassified probably benign
IGL02118:Zfp598 APN 17 24677617 missense probably damaging 1.00
IGL02178:Zfp598 APN 17 24677543 missense probably damaging 1.00
IGL02591:Zfp598 APN 17 24677504 missense probably damaging 1.00
IGL03061:Zfp598 APN 17 24679592 missense probably benign 0.03
FR4304:Zfp598 UTSW 17 24680775 small insertion probably benign
FR4340:Zfp598 UTSW 17 24679372 small deletion probably benign
FR4340:Zfp598 UTSW 17 24680783 small insertion probably benign
FR4342:Zfp598 UTSW 17 24680780 small insertion probably benign
FR4449:Zfp598 UTSW 17 24680776 small insertion probably benign
FR4449:Zfp598 UTSW 17 24680785 small insertion probably benign
FR4548:Zfp598 UTSW 17 24680775 small insertion probably benign
FR4548:Zfp598 UTSW 17 24680776 small insertion probably benign
FR4589:Zfp598 UTSW 17 24680779 small insertion probably benign
FR4737:Zfp598 UTSW 17 24680776 small insertion probably benign
FR4737:Zfp598 UTSW 17 24680782 small insertion probably benign
FR4737:Zfp598 UTSW 17 24680791 small insertion probably benign
FR4976:Zfp598 UTSW 17 24679372 small deletion probably benign
FR4976:Zfp598 UTSW 17 24680782 small insertion probably benign
R0309:Zfp598 UTSW 17 24678584 splice site probably benign
R1295:Zfp598 UTSW 17 24679649 missense probably benign 0.00
R1296:Zfp598 UTSW 17 24679649 missense probably benign 0.00
R1471:Zfp598 UTSW 17 24680072 missense probably benign 0.00
R1523:Zfp598 UTSW 17 24678629 missense probably null 1.00
R1819:Zfp598 UTSW 17 24681130 unclassified probably benign
R2001:Zfp598 UTSW 17 24669924 missense possibly damaging 0.94
R4447:Zfp598 UTSW 17 24676555 missense probably damaging 1.00
R5086:Zfp598 UTSW 17 24680898 unclassified probably benign
R5923:Zfp598 UTSW 17 24677549 missense probably damaging 1.00
R6191:Zfp598 UTSW 17 24677876 missense possibly damaging 0.89
R6680:Zfp598 UTSW 17 24678686 missense probably benign 0.06
R7438:Zfp598 UTSW 17 24677530 missense probably damaging 1.00
R7870:Zfp598 UTSW 17 24679330 missense probably damaging 0.98
RF009:Zfp598 UTSW 17 24680787 small insertion probably benign
RF016:Zfp598 UTSW 17 24680771 small insertion probably benign
RF018:Zfp598 UTSW 17 24680771 small insertion probably benign
RF053:Zfp598 UTSW 17 24680761 small insertion probably benign
RF058:Zfp598 UTSW 17 24680761 small insertion probably benign
RF061:Zfp598 UTSW 17 24680770 small insertion probably benign
RF064:Zfp598 UTSW 17 24680783 small insertion probably benign
Z1088:Zfp598 UTSW 17 24680210 small insertion probably benign
Z1177:Zfp598 UTSW 17 24679639 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGTGTAACTCTAACCAGTCCTTC -3'
(R):5'- AGAAGACACAGCTACCGTGG -3'

Sequencing Primer
(F):5'- CCCTCCTTGGACCCAGTAC -3'
(R):5'- ACAGTGAGGCCACCGCTATC -3'
Posted On2014-09-17