Incidental Mutation 'R2080:Zfp598'
ID 229445
Institutional Source Beutler Lab
Gene Symbol Zfp598
Ensembl Gene ENSMUSG00000041130
Gene Name zinc finger protein 598
Synonyms
MMRRC Submission 040085-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.967) question?
Stock # R2080 (G1)
Quality Score 225
Status Validated
Chromosome 17
Chromosomal Location 24888661-24900990 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to C at 24898641 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Alanine at position 480 (D480A)
Ref Sequence ENSEMBL: ENSMUSP00000038367 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000047179]
AlphaFold Q80YR4
Predicted Effect probably damaging
Transcript: ENSMUST00000047179
AA Change: D480A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000038367
Gene: ENSMUSG00000041130
AA Change: D480A

DomainStartEndE-ValueType
low complexity region 2 23 N/A INTRINSIC
RING 27 66 4.73e-1 SMART
ZnF_C2H2 115 140 9.46e0 SMART
low complexity region 144 153 N/A INTRINSIC
ZnF_C2H2 185 208 5.2e0 SMART
ZnF_C2H2 209 237 7.11e0 SMART
ZnF_C2H2 238 268 6.47e1 SMART
low complexity region 311 331 N/A INTRINSIC
low complexity region 344 356 N/A INTRINSIC
low complexity region 371 385 N/A INTRINSIC
low complexity region 445 454 N/A INTRINSIC
low complexity region 482 501 N/A INTRINSIC
low complexity region 526 544 N/A INTRINSIC
low complexity region 581 589 N/A INTRINSIC
low complexity region 645 663 N/A INTRINSIC
low complexity region 668 683 N/A INTRINSIC
low complexity region 694 748 N/A INTRINSIC
ZnF_C2H2 869 890 8.84e1 SMART
Meta Mutation Damage Score 0.3213 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.2%
  • 20x: 94.7%
Validation Efficiency 100% (55/55)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Zinc-finger proteins bind nucleic acids and play important roles in various cellular functions, including cell proliferation, differentiation, and apoptosis. This protein and Grb10-interacting GYF protein 2 have been identified as a components of the mammalian 4EHP (m4EHP) complex. The complex is thought to function as a translation repressor in embryonic development. [provided by RefSeq, Oct 2012]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310003L06Rik A T 5: 88,119,792 (GRCm39) D183V probably damaging Het
Ambra1 T A 2: 91,716,064 (GRCm39) D858E probably damaging Het
Amdhd2 T C 17: 24,375,578 (GRCm39) T370A probably benign Het
Amy1 A G 3: 113,351,743 (GRCm39) W449R probably benign Het
Aox3 A T 1: 58,225,439 (GRCm39) I1179F probably benign Het
Atp10a C A 7: 58,474,075 (GRCm39) Q1121K probably damaging Het
Btaf1 C T 19: 36,928,548 (GRCm39) A123V probably benign Het
Car6 T C 4: 150,282,598 (GRCm39) K16E probably benign Het
Cgnl1 C T 9: 71,563,378 (GRCm39) D779N probably benign Het
Cyp2a4 G A 7: 26,007,962 (GRCm39) R123Q possibly damaging Het
D430041D05Rik C T 2: 103,987,161 (GRCm39) R1895Q probably damaging Het
D5Ertd579e T A 5: 36,773,550 (GRCm39) T282S probably benign Het
Dsel T C 1: 111,787,692 (GRCm39) T948A probably benign Het
Ednrb A T 14: 104,080,536 (GRCm39) I126N probably damaging Het
Egln1 A G 8: 125,675,045 (GRCm39) M250T probably benign Het
Epb41l3 A T 17: 69,560,463 (GRCm39) I337L possibly damaging Het
Epg5 T C 18: 77,991,960 (GRCm39) I219T probably benign Het
Gm13030 T C 4: 138,600,730 (GRCm39) probably benign Het
Gm1527 T A 3: 28,980,810 (GRCm39) C637S probably benign Het
H1f1 A G 13: 23,947,932 (GRCm39) N78S possibly damaging Het
Insrr T C 3: 87,721,598 (GRCm39) I1168T possibly damaging Het
Ireb2 T C 9: 54,803,836 (GRCm39) V509A possibly damaging Het
Kmt2c T C 5: 25,559,715 (GRCm39) D981G probably damaging Het
Ktn1 A G 14: 47,963,417 (GRCm39) E1164G probably damaging Het
L3hypdh A T 12: 72,126,301 (GRCm39) V213E probably damaging Het
Masp1 T G 16: 23,310,709 (GRCm39) D241A probably damaging Het
Mfsd13b A G 7: 120,591,047 (GRCm39) I1V probably null Het
Muc5b T C 7: 141,423,491 (GRCm39) V4531A probably benign Het
Myh2 A T 11: 67,065,767 (GRCm39) probably null Het
Naip5 A G 13: 100,358,041 (GRCm39) L1065P probably damaging Het
Necab1 T C 4: 15,140,219 (GRCm39) probably benign Het
Nemf A G 12: 69,400,560 (GRCm39) probably benign Het
Nfil3 A T 13: 53,122,069 (GRCm39) D278E possibly damaging Het
Nup98 T C 7: 101,829,631 (GRCm39) N393S probably damaging Het
Ogdh T A 11: 6,299,393 (GRCm39) M753K probably benign Het
Or13c3 T C 4: 52,855,568 (GRCm39) Y315C probably benign Het
Or2b6 A T 13: 21,823,606 (GRCm39) V29E probably damaging Het
Or4k47 C T 2: 111,452,084 (GRCm39) V112M probably benign Het
Or51f5 T C 7: 102,424,450 (GRCm39) F240L probably benign Het
Or8b42 T A 9: 38,342,378 (GRCm39) S267T probably benign Het
Pkd2 A G 5: 104,624,989 (GRCm39) K262E probably benign Het
Plce1 C T 19: 38,715,457 (GRCm39) probably benign Het
Ppm1f T A 16: 16,741,744 (GRCm39) M406K possibly damaging Het
Ptgs1 C T 2: 36,132,859 (GRCm39) Q286* probably null Het
Scube2 T C 7: 109,407,712 (GRCm39) T743A possibly damaging Het
Tipin T A 9: 64,197,658 (GRCm39) L69* probably null Het
Tlk1 T A 2: 70,568,789 (GRCm39) K404N probably damaging Het
Tmem59 C A 4: 107,035,971 (GRCm39) L16I probably damaging Het
Utrn T C 10: 12,612,826 (GRCm39) E426G probably benign Het
Xdh A T 17: 74,216,320 (GRCm39) S709T probably damaging Het
Yjefn3 T C 8: 70,342,137 (GRCm39) N28D probably damaging Het
Other mutations in Zfp598
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01358:Zfp598 APN 17 24,900,398 (GRCm39) unclassified probably benign
IGL02118:Zfp598 APN 17 24,896,591 (GRCm39) missense probably damaging 1.00
IGL02178:Zfp598 APN 17 24,896,517 (GRCm39) missense probably damaging 1.00
IGL02591:Zfp598 APN 17 24,896,478 (GRCm39) missense probably damaging 1.00
IGL03061:Zfp598 APN 17 24,898,566 (GRCm39) missense probably benign 0.03
FR4304:Zfp598 UTSW 17 24,899,749 (GRCm39) small insertion probably benign
FR4340:Zfp598 UTSW 17 24,899,757 (GRCm39) small insertion probably benign
FR4340:Zfp598 UTSW 17 24,898,346 (GRCm39) small deletion probably benign
FR4342:Zfp598 UTSW 17 24,899,754 (GRCm39) small insertion probably benign
FR4449:Zfp598 UTSW 17 24,899,759 (GRCm39) small insertion probably benign
FR4449:Zfp598 UTSW 17 24,899,750 (GRCm39) small insertion probably benign
FR4548:Zfp598 UTSW 17 24,899,750 (GRCm39) small insertion probably benign
FR4548:Zfp598 UTSW 17 24,899,749 (GRCm39) small insertion probably benign
FR4589:Zfp598 UTSW 17 24,899,753 (GRCm39) small insertion probably benign
FR4737:Zfp598 UTSW 17 24,899,765 (GRCm39) small insertion probably benign
FR4737:Zfp598 UTSW 17 24,899,750 (GRCm39) small insertion probably benign
FR4737:Zfp598 UTSW 17 24,899,756 (GRCm39) small insertion probably benign
FR4976:Zfp598 UTSW 17 24,898,346 (GRCm39) small deletion probably benign
FR4976:Zfp598 UTSW 17 24,899,756 (GRCm39) small insertion probably benign
R0309:Zfp598 UTSW 17 24,897,558 (GRCm39) splice site probably benign
R1295:Zfp598 UTSW 17 24,898,623 (GRCm39) missense probably benign 0.00
R1296:Zfp598 UTSW 17 24,898,623 (GRCm39) missense probably benign 0.00
R1471:Zfp598 UTSW 17 24,899,046 (GRCm39) missense probably benign 0.00
R1523:Zfp598 UTSW 17 24,897,603 (GRCm39) missense probably null 1.00
R1819:Zfp598 UTSW 17 24,900,104 (GRCm39) unclassified probably benign
R2001:Zfp598 UTSW 17 24,888,898 (GRCm39) missense possibly damaging 0.94
R4447:Zfp598 UTSW 17 24,895,529 (GRCm39) missense probably damaging 1.00
R5086:Zfp598 UTSW 17 24,899,872 (GRCm39) unclassified probably benign
R5923:Zfp598 UTSW 17 24,896,523 (GRCm39) missense probably damaging 1.00
R6191:Zfp598 UTSW 17 24,896,850 (GRCm39) missense possibly damaging 0.89
R6680:Zfp598 UTSW 17 24,897,660 (GRCm39) missense probably benign 0.06
R7438:Zfp598 UTSW 17 24,896,504 (GRCm39) missense probably damaging 1.00
R7870:Zfp598 UTSW 17 24,898,304 (GRCm39) missense probably damaging 0.98
R9513:Zfp598 UTSW 17 24,896,568 (GRCm39) missense probably damaging 0.97
RF009:Zfp598 UTSW 17 24,899,761 (GRCm39) small insertion probably benign
RF016:Zfp598 UTSW 17 24,899,745 (GRCm39) small insertion probably benign
RF018:Zfp598 UTSW 17 24,899,745 (GRCm39) small insertion probably benign
RF053:Zfp598 UTSW 17 24,899,735 (GRCm39) small insertion probably benign
RF058:Zfp598 UTSW 17 24,899,735 (GRCm39) small insertion probably benign
RF061:Zfp598 UTSW 17 24,899,744 (GRCm39) small insertion probably benign
RF064:Zfp598 UTSW 17 24,899,757 (GRCm39) small insertion probably benign
Z1088:Zfp598 UTSW 17 24,899,184 (GRCm39) small insertion probably benign
Z1177:Zfp598 UTSW 17 24,898,613 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGTGTAACTCTAACCAGTCCTTC -3'
(R):5'- AGAAGACACAGCTACCGTGG -3'

Sequencing Primer
(F):5'- CCCTCCTTGGACCCAGTAC -3'
(R):5'- ACAGTGAGGCCACCGCTATC -3'
Posted On 2014-09-17