Incidental Mutation 'R2169:4833420G17Rik'
ID235683
Institutional Source Beutler Lab
Gene Symbol 4833420G17Rik
Ensembl Gene ENSMUSG00000062822
Gene NameRIKEN cDNA 4833420G17 gene
Synonyms
MMRRC Submission 040172-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2169 (G1)
Quality Score225
Status Not validated
Chromosome13
Chromosomal Location119462768-119486120 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 119485813 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 606 (T606A)
Ref Sequence ENSEMBL: ENSMUSP00000153079 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026519] [ENSMUST00000099147] [ENSMUST00000099148] [ENSMUST00000176171] [ENSMUST00000223912] [ENSMUST00000224312] [ENSMUST00000225186] [ENSMUST00000225726]
Predicted Effect probably benign
Transcript: ENSMUST00000026519
AA Change: T606A

PolyPhen 2 Score 0.088 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000026519
Gene: ENSMUSG00000062822
AA Change: T606A

DomainStartEndE-ValueType
Pfam:DUF4524 9 154 5e-61 PFAM
Pfam:DUF4520 451 542 8.6e-37 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000099147
SMART Domains Protein: ENSMUSP00000096751
Gene: ENSMUSG00000074634

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
transmembrane domain 136 158 N/A INTRINSIC
transmembrane domain 202 224 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000099148
SMART Domains Protein: ENSMUSP00000096752
Gene: ENSMUSG00000074635

DomainStartEndE-ValueType
low complexity region 66 80 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000176171
SMART Domains Protein: ENSMUSP00000135685
Gene: ENSMUSG00000074634

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
transmembrane domain 136 158 N/A INTRINSIC
transmembrane domain 202 224 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000177361
SMART Domains Protein: ENSMUSP00000134785
Gene: ENSMUSG00000074634

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000223912
Predicted Effect probably benign
Transcript: ENSMUST00000224312
AA Change: T606A

PolyPhen 2 Score 0.088 (Sensitivity: 0.93; Specificity: 0.85)
Predicted Effect probably benign
Transcript: ENSMUST00000225186
AA Change: T606A

PolyPhen 2 Score 0.088 (Sensitivity: 0.93; Specificity: 0.85)
Predicted Effect probably benign
Transcript: ENSMUST00000225726
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.5%
  • 20x: 95.6%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adtrp T A 13: 41,767,429 S221C possibly damaging Het
Ap1g2 T A 14: 55,099,340 probably null Het
Arhgef5 A T 6: 43,274,420 M702L probably benign Het
Axdnd1 A G 1: 156,418,309 V34A probably damaging Het
Ccdc154 T A 17: 25,170,923 V509E probably damaging Het
Cttnbp2 C T 6: 18,426,097 D761N probably benign Het
Ddx18 A T 1: 121,558,409 probably null Het
Fam241b A T 10: 62,109,966 I4N probably damaging Het
Fam69a A T 5: 107,909,459 L411* probably null Het
Gm5800 T C 14: 51,713,678 K155E possibly damaging Het
Hemgn T A 4: 46,396,417 H273L possibly damaging Het
Hsp90aa1 A G 12: 110,692,734 V543A probably damaging Het
Hspa1l A G 17: 34,977,323 K113E probably benign Het
Hspb2 A G 9: 50,751,715 I38T probably damaging Het
Htt A T 5: 34,877,475 E2021D probably benign Het
Lrpprc C T 17: 84,770,077 R394Q probably benign Het
Lrrc8b T C 5: 105,481,887 Y700H probably damaging Het
Mefv A G 16: 3,710,888 V593A probably benign Het
Mrgprh C T 17: 12,876,969 T32M probably benign Het
Mrpl18 A G 17: 12,913,768 probably null Het
Muc1 A G 3: 89,231,596 E504G probably damaging Het
Ndufa13 G A 8: 69,894,519 A77V probably damaging Het
Olfr952 A G 9: 39,426,358 F238L possibly damaging Het
Pgbd5 T A 8: 124,384,624 probably null Het
Pgm5 T A 19: 24,834,815 I118F probably damaging Het
Phyhip T C 14: 70,467,132 F264L possibly damaging Het
Polr3e C T 7: 120,932,137 R176W probably damaging Het
Prkacb C T 3: 146,746,683 probably null Het
Rab19 T G 6: 39,384,041 V41G possibly damaging Het
Rapgef5 A G 12: 117,715,395 Y234C probably benign Het
Slc26a5 T C 5: 21,813,865 T659A probably damaging Het
Slc6a2 G A 8: 92,994,101 V449I probably benign Het
Stab2 A G 10: 86,887,862 S1490P probably damaging Het
Tln1 T C 4: 43,548,005 T713A probably damaging Het
Tmc6 A T 11: 117,769,106 L732Q probably damaging Het
Unc80 C T 1: 66,521,581 H823Y possibly damaging Het
Vmn1r203 A T 13: 22,524,735 K229* probably null Het
Xylt1 G A 7: 117,667,437 G893R probably damaging Het
Ythdf1 A T 2: 180,912,114 S69T probably damaging Het
Zfp114 C T 7: 24,181,084 T285I probably benign Het
Zfp458 T C 13: 67,257,049 E439G probably damaging Het
Zfp65 G A 13: 67,710,380 T55I probably damaging Het
Zmym1 C T 4: 127,054,203 probably null Het
Other mutations in 4833420G17Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01531:4833420G17Rik APN 13 119466958 critical splice donor site probably null
IGL01555:4833420G17Rik APN 13 119473907 missense probably benign 0.10
IGL02395:4833420G17Rik APN 13 119480960 missense probably damaging 1.00
IGL02725:4833420G17Rik APN 13 119474909 missense possibly damaging 0.95
IGL02904:4833420G17Rik APN 13 119484454 missense probably damaging 1.00
IGL03126:4833420G17Rik APN 13 119481027 missense probably benign 0.23
R0410:4833420G17Rik UTSW 13 119469732 missense probably benign
R0437:4833420G17Rik UTSW 13 119470095 missense probably benign 0.35
R0513:4833420G17Rik UTSW 13 119469659 missense probably benign 0.13
R0569:4833420G17Rik UTSW 13 119484480 missense possibly damaging 0.94
R0788:4833420G17Rik UTSW 13 119473932 nonsense probably null
R1495:4833420G17Rik UTSW 13 119477820 missense probably benign 0.17
R1617:4833420G17Rik UTSW 13 119466937 missense probably damaging 1.00
R1905:4833420G17Rik UTSW 13 119469680 missense possibly damaging 0.92
R1914:4833420G17Rik UTSW 13 119485850 missense possibly damaging 0.90
R4238:4833420G17Rik UTSW 13 119466942 missense probably benign 0.00
R4240:4833420G17Rik UTSW 13 119466942 missense probably benign 0.00
R4295:4833420G17Rik UTSW 13 119469713 missense probably benign 0.02
R4469:4833420G17Rik UTSW 13 119469809 missense probably damaging 1.00
R4643:4833420G17Rik UTSW 13 119474860 missense probably damaging 0.97
R4964:4833420G17Rik UTSW 13 119474221 intron probably benign
R4966:4833420G17Rik UTSW 13 119474221 intron probably benign
R5093:4833420G17Rik UTSW 13 119474037 utr 3 prime probably benign
R5384:4833420G17Rik UTSW 13 119469960 missense probably benign 0.01
R6255:4833420G17Rik UTSW 13 119466123 missense possibly damaging 0.95
R6491:4833420G17Rik UTSW 13 119475972 missense probably damaging 1.00
R6564:4833420G17Rik UTSW 13 119486077 splice site probably null
R7023:4833420G17Rik UTSW 13 119473907 missense probably benign 0.10
R7574:4833420G17Rik UTSW 13 119469942 missense probably damaging 0.99
Z1176:4833420G17Rik UTSW 13 119477808 missense not run
Z1177:4833420G17Rik UTSW 13 119477808 missense not run
Predicted Primers PCR Primer
(F):5'- AAAGTCCCAGTGCTGTCAAG -3'
(R):5'- TCTTGGGTCTGTAGCAATTCC -3'

Sequencing Primer
(F):5'- GTCCCAGTGCTGTCAAGAATTCAG -3'
(R):5'- GGGTCTGTAGCAATTCCACACTAG -3'
Posted On2014-10-01