Incidental Mutation 'R4397:Map3k12'
ID 325562
Institutional Source Beutler Lab
Gene Symbol Map3k12
Ensembl Gene ENSMUSG00000023050
Gene Name mitogen-activated protein kinase kinase kinase 12
Synonyms MUK, DLK, Zpk
MMRRC Submission 041685-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R4397 (G1)
Quality Score 225
Status Validated
Chromosome 15
Chromosomal Location 102497646-102517064 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) C to T at 102501259 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Alanine to Threonine at position 694 (A694T)
Ref Sequence ENSEMBL: ENSMUSP00000127629 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023812] [ENSMUST00000077037] [ENSMUST00000078404] [ENSMUST00000096145] [ENSMUST00000108838] [ENSMUST00000165174] [ENSMUST00000169162] [ENSMUST00000169367] [ENSMUST00000169377] [ENSMUST00000171565] [ENSMUST00000229061] [ENSMUST00000229184] [ENSMUST00000229618] [ENSMUST00000229802] [ENSMUST00000229854] [ENSMUST00000230114] [ENSMUST00000231085] [ENSMUST00000229918]
AlphaFold Q60700
Predicted Effect probably benign
Transcript: ENSMUST00000023812
AA Change: A694T

PolyPhen 2 Score 0.439 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000023812
Gene: ENSMUSG00000023050
AA Change: A694T

DomainStartEndE-ValueType
low complexity region 54 75 N/A INTRINSIC
Pfam:Pkinase 158 397 3.3e-59 PFAM
Pfam:Pkinase_Tyr 159 397 2.7e-62 PFAM
coiled coil region 447 501 N/A INTRINSIC
low complexity region 559 577 N/A INTRINSIC
low complexity region 599 617 N/A INTRINSIC
low complexity region 640 663 N/A INTRINSIC
low complexity region 664 678 N/A INTRINSIC
low complexity region 691 727 N/A INTRINSIC
low complexity region 751 764 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000077037
SMART Domains Protein: ENSMUSP00000076294
Gene: ENSMUSG00000056851

DomainStartEndE-ValueType
KH 12 80 5.96e-15 SMART
KH 96 167 2.48e-12 SMART
KH 283 353 5.19e-15 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000078404
SMART Domains Protein: ENSMUSP00000077509
Gene: ENSMUSG00000056851

DomainStartEndE-ValueType
KH 12 80 5.96e-15 SMART
KH 96 167 2.48e-12 SMART
KH 270 340 5.19e-15 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000096145
SMART Domains Protein: ENSMUSP00000093859
Gene: ENSMUSG00000071586

DomainStartEndE-ValueType
low complexity region 29 37 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000108838
SMART Domains Protein: ENSMUSP00000104466
Gene: ENSMUSG00000056851

DomainStartEndE-ValueType
KH 12 80 5.96e-15 SMART
KH 96 167 2.48e-12 SMART
KH 252 322 5.19e-15 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000164343
Predicted Effect probably benign
Transcript: ENSMUST00000165174
Predicted Effect probably benign
Transcript: ENSMUST00000169162
Predicted Effect probably benign
Transcript: ENSMUST00000169367
Predicted Effect probably benign
Transcript: ENSMUST00000169377
AA Change: A694T

PolyPhen 2 Score 0.439 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000133209
Gene: ENSMUSG00000023050
AA Change: A694T

DomainStartEndE-ValueType
low complexity region 54 75 N/A INTRINSIC
Pfam:Pkinase 159 397 1.2e-58 PFAM
Pfam:Pkinase_Tyr 160 397 3.7e-62 PFAM
coiled coil region 447 501 N/A INTRINSIC
low complexity region 559 577 N/A INTRINSIC
low complexity region 599 617 N/A INTRINSIC
low complexity region 640 663 N/A INTRINSIC
low complexity region 664 678 N/A INTRINSIC
low complexity region 691 727 N/A INTRINSIC
low complexity region 751 764 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000171565
AA Change: A694T

PolyPhen 2 Score 0.439 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000127629
Gene: ENSMUSG00000023050
AA Change: A694T

DomainStartEndE-ValueType
low complexity region 54 75 N/A INTRINSIC
Pfam:Pkinase 158 397 3.3e-59 PFAM
Pfam:Pkinase_Tyr 159 397 2.7e-62 PFAM
coiled coil region 447 501 N/A INTRINSIC
low complexity region 559 577 N/A INTRINSIC
low complexity region 599 617 N/A INTRINSIC
low complexity region 640 663 N/A INTRINSIC
low complexity region 664 678 N/A INTRINSIC
low complexity region 691 727 N/A INTRINSIC
low complexity region 751 764 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000229061
Predicted Effect probably benign
Transcript: ENSMUST00000229184
Predicted Effect probably benign
Transcript: ENSMUST00000229432
Predicted Effect probably benign
Transcript: ENSMUST00000229618
Predicted Effect probably benign
Transcript: ENSMUST00000229802
Predicted Effect noncoding transcript
Transcript: ENSMUST00000229822
Predicted Effect probably benign
Transcript: ENSMUST00000229854
Predicted Effect probably benign
Transcript: ENSMUST00000230114
Predicted Effect probably benign
Transcript: ENSMUST00000231085
Predicted Effect probably benign
Transcript: ENSMUST00000229918
Predicted Effect noncoding transcript
Transcript: ENSMUST00000230631
Meta Mutation Damage Score 0.0592 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.1%
Validation Efficiency 96% (55/57)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the serine/threonine protein kinase family. This kinase contains a leucine-zipper domain and is predominately expressed in neuronal cells. The phosphorylation state of this kinase in synaptic terminals was shown to be regulated by membrane depolarization via calcineurin. This kinase forms heterodimers with leucine zipper containing transcription factors, such as cAMP responsive element binding protein (CREB) and MYC, and thus may play a regulatory role in PKA or retinoic acid induced neuronal differentiation. Alternatively spliced transcript variants encoding different proteins have been described.[provided by RefSeq, Jul 2010]
PHENOTYPE: Mice homozygous for a gene-trapped allele lack the brain anterior commissure. Mice homozygous for a knock-out allele exhibit postnatal lethality and abnormal axon growth and radial migration of neocortical pyramidal neurons. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrg4 T G X: 56,932,343 L2193V probably damaging Het
Agap2 G A 10: 127,090,483 A866T unknown Het
Aig1 A C 10: 13,652,982 S237A probably benign Het
Baz1b C T 5: 135,244,446 R1475W probably damaging Het
Bmp1 C T 14: 70,490,542 probably null Het
Crybg3 A G 16: 59,560,095 probably benign Het
Dnajc15 T C 14: 77,874,794 probably null Het
Fam135b T A 15: 71,448,676 H1334L probably benign Het
Fancg A T 4: 43,008,897 H113Q probably benign Het
Gfap G A 11: 102,896,984 A45V probably benign Het
Gjd3 A T 11: 98,982,421 L199Q probably damaging Het
Gm8979 A G 7: 106,082,923 noncoding transcript Het
H13 A G 2: 152,677,552 D65G probably damaging Het
Hcls1 T C 16: 36,937,300 V5A possibly damaging Het
Hjurp GT GTT 1: 88,266,524 probably null Het
Homer3 G A 8: 70,290,143 probably null Het
Iqgap3 T C 3: 88,104,358 Y817H probably damaging Het
Iqsec2 C T X: 152,209,053 T562I probably damaging Het
Klb A G 5: 65,380,039 Y904C probably damaging Het
Kremen1 A T 11: 5,199,610 S354T probably benign Het
Lamc3 A G 2: 31,931,952 E1304G probably benign Het
Lrp4 T C 2: 91,511,670 V1876A probably benign Het
Magi3 T C 3: 104,219,714 T85A probably damaging Het
Mex3b T C 7: 82,869,823 S449P possibly damaging Het
Naip6 C T 13: 100,300,600 A472T probably benign Het
Nars2 T C 7: 96,973,564 probably null Het
Nlrp1a T G 11: 71,097,204 M1046L probably benign Het
Nphs1 T G 7: 30,481,965 probably null Het
Nup133 G A 8: 123,944,301 T119M probably benign Het
Olfr770 G T 10: 129,133,581 N62K possibly damaging Het
Pcdhga9 A T 18: 37,738,641 I508F probably damaging Het
Phactr3 A G 2: 178,175,406 probably benign Het
Plcb3 T C 19: 6,965,825 K155E probably damaging Het
Plxna2 C T 1: 194,749,317 S538F probably damaging Het
Prss38 T C 11: 59,373,028 Y286C probably damaging Het
Psg16 T C 7: 17,090,698 S45P possibly damaging Het
Ptpn21 G T 12: 98,688,248 P820Q probably damaging Het
Ptpn21 A G 12: 98,715,060 V105A probably damaging Het
Rnf7 A G 9: 96,478,410 M58T probably benign Het
Slc25a11 G A 11: 70,644,851 A287V probably benign Het
Slit2 G T 5: 48,220,081 probably null Het
Suco A G 1: 161,844,852 Y460H probably damaging Het
Tnxb C T 17: 34,678,662 Q804* probably null Het
Trpv6 A G 6: 41,625,238 I379T possibly damaging Het
Ugt1a1 CAGAGAGAGAGAGA CAGAGAGAGAGA 1: 88,211,984 probably benign Het
Virma A G 4: 11,513,901 E585G possibly damaging Het
Vmn2r79 A G 7: 87,001,891 H166R possibly damaging Het
Vmn2r88 A T 14: 51,417,978 D549V probably damaging Het
Other mutations in Map3k12
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01615:Map3k12 APN 15 102503751 missense probably damaging 1.00
IGL01713:Map3k12 APN 15 102502321 missense probably damaging 1.00
IGL01720:Map3k12 APN 15 102502186 unclassified probably benign
IGL02262:Map3k12 APN 15 102502075 missense probably damaging 1.00
IGL02670:Map3k12 APN 15 102503546 missense probably benign 0.09
IGL03004:Map3k12 APN 15 102504196 missense possibly damaging 0.96
IGL03369:Map3k12 APN 15 102502079 missense possibly damaging 0.47
react UTSW 15 102505402 missense probably damaging 1.00
R0894:Map3k12 UTSW 15 102502178 missense probably damaging 1.00
R0918:Map3k12 UTSW 15 102503852 missense probably damaging 0.99
R1547:Map3k12 UTSW 15 102503852 missense probably damaging 1.00
R1844:Map3k12 UTSW 15 102503535 missense probably damaging 1.00
R1880:Map3k12 UTSW 15 102502064 critical splice donor site probably null
R2292:Map3k12 UTSW 15 102500139 missense probably damaging 0.96
R4406:Map3k12 UTSW 15 102505402 missense probably damaging 1.00
R4407:Map3k12 UTSW 15 102505402 missense probably damaging 1.00
R4408:Map3k12 UTSW 15 102505402 missense probably damaging 1.00
R4731:Map3k12 UTSW 15 102501282 missense probably benign 0.28
R5074:Map3k12 UTSW 15 102501832 critical splice donor site probably null
R5605:Map3k12 UTSW 15 102503865 missense probably benign 0.17
R5848:Map3k12 UTSW 15 102504235 missense possibly damaging 0.66
R6232:Map3k12 UTSW 15 102503646 missense probably damaging 0.99
R6901:Map3k12 UTSW 15 102500629 missense possibly damaging 0.95
R6901:Map3k12 UTSW 15 102500630 missense possibly damaging 0.65
R6946:Map3k12 UTSW 15 102505134 missense possibly damaging 0.89
R7291:Map3k12 UTSW 15 102502166 missense probably damaging 1.00
R7874:Map3k12 UTSW 15 102500642 missense possibly damaging 0.91
R8331:Map3k12 UTSW 15 102502331 nonsense probably null
R8460:Map3k12 UTSW 15 102501597 missense probably damaging 1.00
R8784:Map3k12 UTSW 15 102505362 missense possibly damaging 0.51
Predicted Primers PCR Primer
(F):5'- TAGCACTTGGACCCATGAGG -3'
(R):5'- CCTTCTACTCCGAAAGATGTCATC -3'

Sequencing Primer
(F):5'- TGTGGGGTAGAAGAACATCCCC -3'
(R):5'- GATGTCATCATCATCCCCAGACCTG -3'
Posted On 2015-07-06