Incidental Mutation 'R4397:Map3k12'
ID 325562
Institutional Source Beutler Lab
Gene Symbol Map3k12
Ensembl Gene ENSMUSG00000023050
Gene Name mitogen-activated protein kinase kinase kinase 12
Synonyms MUK, DLK, Zpk
MMRRC Submission 041685-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R4397 (G1)
Quality Score 225
Status Validated
Chromosome 15
Chromosomal Location 102406079-102425311 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to T at 102409694 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Alanine to Threonine at position 694 (A694T)
Ref Sequence ENSEMBL: ENSMUSP00000127629 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023812] [ENSMUST00000077037] [ENSMUST00000078404] [ENSMUST00000096145] [ENSMUST00000108838] [ENSMUST00000165174] [ENSMUST00000169162] [ENSMUST00000169367] [ENSMUST00000169377] [ENSMUST00000171565] [ENSMUST00000230114] [ENSMUST00000229618] [ENSMUST00000231085] [ENSMUST00000229918] [ENSMUST00000229802] [ENSMUST00000229061] [ENSMUST00000229184] [ENSMUST00000229854]
AlphaFold Q60700
Predicted Effect probably benign
Transcript: ENSMUST00000023812
AA Change: A694T

PolyPhen 2 Score 0.439 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000023812
Gene: ENSMUSG00000023050
AA Change: A694T

DomainStartEndE-ValueType
low complexity region 54 75 N/A INTRINSIC
Pfam:Pkinase 158 397 3.3e-59 PFAM
Pfam:Pkinase_Tyr 159 397 2.7e-62 PFAM
coiled coil region 447 501 N/A INTRINSIC
low complexity region 559 577 N/A INTRINSIC
low complexity region 599 617 N/A INTRINSIC
low complexity region 640 663 N/A INTRINSIC
low complexity region 664 678 N/A INTRINSIC
low complexity region 691 727 N/A INTRINSIC
low complexity region 751 764 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000077037
SMART Domains Protein: ENSMUSP00000076294
Gene: ENSMUSG00000056851

DomainStartEndE-ValueType
KH 12 80 5.96e-15 SMART
KH 96 167 2.48e-12 SMART
KH 283 353 5.19e-15 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000078404
SMART Domains Protein: ENSMUSP00000077509
Gene: ENSMUSG00000056851

DomainStartEndE-ValueType
KH 12 80 5.96e-15 SMART
KH 96 167 2.48e-12 SMART
KH 270 340 5.19e-15 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000096145
SMART Domains Protein: ENSMUSP00000093859
Gene: ENSMUSG00000071586

DomainStartEndE-ValueType
low complexity region 29 37 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000108838
SMART Domains Protein: ENSMUSP00000104466
Gene: ENSMUSG00000056851

DomainStartEndE-ValueType
KH 12 80 5.96e-15 SMART
KH 96 167 2.48e-12 SMART
KH 252 322 5.19e-15 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000164343
Predicted Effect probably benign
Transcript: ENSMUST00000165174
Predicted Effect probably benign
Transcript: ENSMUST00000169162
Predicted Effect probably benign
Transcript: ENSMUST00000169367
Predicted Effect probably benign
Transcript: ENSMUST00000169377
AA Change: A694T

PolyPhen 2 Score 0.439 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000133209
Gene: ENSMUSG00000023050
AA Change: A694T

DomainStartEndE-ValueType
low complexity region 54 75 N/A INTRINSIC
Pfam:Pkinase 159 397 1.2e-58 PFAM
Pfam:Pkinase_Tyr 160 397 3.7e-62 PFAM
coiled coil region 447 501 N/A INTRINSIC
low complexity region 559 577 N/A INTRINSIC
low complexity region 599 617 N/A INTRINSIC
low complexity region 640 663 N/A INTRINSIC
low complexity region 664 678 N/A INTRINSIC
low complexity region 691 727 N/A INTRINSIC
low complexity region 751 764 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000171565
AA Change: A694T

PolyPhen 2 Score 0.439 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000127629
Gene: ENSMUSG00000023050
AA Change: A694T

DomainStartEndE-ValueType
low complexity region 54 75 N/A INTRINSIC
Pfam:Pkinase 158 397 3.3e-59 PFAM
Pfam:Pkinase_Tyr 159 397 2.7e-62 PFAM
coiled coil region 447 501 N/A INTRINSIC
low complexity region 559 577 N/A INTRINSIC
low complexity region 599 617 N/A INTRINSIC
low complexity region 640 663 N/A INTRINSIC
low complexity region 664 678 N/A INTRINSIC
low complexity region 691 727 N/A INTRINSIC
low complexity region 751 764 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000229822
Predicted Effect probably benign
Transcript: ENSMUST00000230114
Predicted Effect probably benign
Transcript: ENSMUST00000229432
Predicted Effect probably benign
Transcript: ENSMUST00000229618
Predicted Effect probably benign
Transcript: ENSMUST00000231085
Predicted Effect probably benign
Transcript: ENSMUST00000229918
Predicted Effect probably benign
Transcript: ENSMUST00000229802
Predicted Effect noncoding transcript
Transcript: ENSMUST00000230631
Predicted Effect probably benign
Transcript: ENSMUST00000229061
Predicted Effect probably benign
Transcript: ENSMUST00000229184
Predicted Effect probably benign
Transcript: ENSMUST00000229854
Meta Mutation Damage Score 0.0592 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.1%
Validation Efficiency 96% (55/57)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the serine/threonine protein kinase family. This kinase contains a leucine-zipper domain and is predominately expressed in neuronal cells. The phosphorylation state of this kinase in synaptic terminals was shown to be regulated by membrane depolarization via calcineurin. This kinase forms heterodimers with leucine zipper containing transcription factors, such as cAMP responsive element binding protein (CREB) and MYC, and thus may play a regulatory role in PKA or retinoic acid induced neuronal differentiation. Alternatively spliced transcript variants encoding different proteins have been described.[provided by RefSeq, Jul 2010]
PHENOTYPE: Mice homozygous for a gene-trapped allele lack the brain anterior commissure. Mice homozygous for a knock-out allele exhibit postnatal lethality and abnormal axon growth and radial migration of neocortical pyramidal neurons. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrg4 T G X: 55,977,703 (GRCm39) L2193V probably damaging Het
Agap2 G A 10: 126,926,352 (GRCm39) A866T unknown Het
Aig1 A C 10: 13,528,726 (GRCm39) S237A probably benign Het
Baz1b C T 5: 135,273,300 (GRCm39) R1475W probably damaging Het
Bmp1 C T 14: 70,727,982 (GRCm39) probably null Het
Crybg3 A G 16: 59,380,458 (GRCm39) probably benign Het
Dnajc15 T C 14: 78,112,234 (GRCm39) probably null Het
Fam135b T A 15: 71,320,525 (GRCm39) H1334L probably benign Het
Fancg A T 4: 43,008,897 (GRCm39) H113Q probably benign Het
Gfap G A 11: 102,787,810 (GRCm39) A45V probably benign Het
Gjd3 A T 11: 98,873,247 (GRCm39) L199Q probably damaging Het
Gvin-ps3 A G 7: 105,682,130 (GRCm39) noncoding transcript Het
H13 A G 2: 152,519,472 (GRCm39) D65G probably damaging Het
Hcls1 T C 16: 36,757,662 (GRCm39) V5A possibly damaging Het
Hjurp GT GTT 1: 88,194,246 (GRCm39) probably null Het
Homer3 G A 8: 70,742,793 (GRCm39) probably null Het
Iqgap3 T C 3: 88,011,665 (GRCm39) Y817H probably damaging Het
Iqsec2 C T X: 150,992,049 (GRCm39) T562I probably damaging Het
Klb A G 5: 65,537,382 (GRCm39) Y904C probably damaging Het
Kremen1 A T 11: 5,149,610 (GRCm39) S354T probably benign Het
Lamc3 A G 2: 31,821,964 (GRCm39) E1304G probably benign Het
Lrp4 T C 2: 91,342,015 (GRCm39) V1876A probably benign Het
Magi3 T C 3: 104,127,030 (GRCm39) T85A probably damaging Het
Mex3b T C 7: 82,519,031 (GRCm39) S449P possibly damaging Het
Naip6 C T 13: 100,437,108 (GRCm39) A472T probably benign Het
Nars2 T C 7: 96,622,771 (GRCm39) probably null Het
Nlrp1a T G 11: 70,988,030 (GRCm39) M1046L probably benign Het
Nphs1 T G 7: 30,181,390 (GRCm39) probably null Het
Nup133 G A 8: 124,671,040 (GRCm39) T119M probably benign Het
Or6c201 G T 10: 128,969,450 (GRCm39) N62K possibly damaging Het
Pcdhga9 A T 18: 37,871,694 (GRCm39) I508F probably damaging Het
Phactr3 A G 2: 177,817,199 (GRCm39) probably benign Het
Plcb3 T C 19: 6,943,193 (GRCm39) K155E probably damaging Het
Plxna2 C T 1: 194,431,625 (GRCm39) S538F probably damaging Het
Prss38 T C 11: 59,263,854 (GRCm39) Y286C probably damaging Het
Psg16 T C 7: 16,824,623 (GRCm39) S45P possibly damaging Het
Ptpn21 G T 12: 98,654,507 (GRCm39) P820Q probably damaging Het
Ptpn21 A G 12: 98,681,319 (GRCm39) V105A probably damaging Het
Rnf7 A G 9: 96,360,463 (GRCm39) M58T probably benign Het
Slc25a11 G A 11: 70,535,677 (GRCm39) A287V probably benign Het
Slit2 G T 5: 48,377,423 (GRCm39) probably null Het
Suco A G 1: 161,672,421 (GRCm39) Y460H probably damaging Het
Tnxb C T 17: 34,897,636 (GRCm39) Q804* probably null Het
Trpv6 A G 6: 41,602,172 (GRCm39) I379T possibly damaging Het
Ugt1a1 CAGAGAGAGAGAGA CAGAGAGAGAGA 1: 88,139,706 (GRCm39) probably benign Het
Virma A G 4: 11,513,901 (GRCm39) E585G possibly damaging Het
Vmn2r79 A G 7: 86,651,099 (GRCm39) H166R possibly damaging Het
Vmn2r88 A T 14: 51,655,435 (GRCm39) D549V probably damaging Het
Other mutations in Map3k12
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01615:Map3k12 APN 15 102,412,186 (GRCm39) missense probably damaging 1.00
IGL01713:Map3k12 APN 15 102,410,756 (GRCm39) missense probably damaging 1.00
IGL01720:Map3k12 APN 15 102,410,621 (GRCm39) unclassified probably benign
IGL02262:Map3k12 APN 15 102,410,510 (GRCm39) missense probably damaging 1.00
IGL02670:Map3k12 APN 15 102,411,981 (GRCm39) missense probably benign 0.09
IGL03004:Map3k12 APN 15 102,412,631 (GRCm39) missense possibly damaging 0.96
IGL03369:Map3k12 APN 15 102,410,514 (GRCm39) missense possibly damaging 0.47
react UTSW 15 102,413,837 (GRCm39) missense probably damaging 1.00
R0894:Map3k12 UTSW 15 102,410,613 (GRCm39) missense probably damaging 1.00
R0918:Map3k12 UTSW 15 102,412,287 (GRCm39) missense probably damaging 0.99
R1547:Map3k12 UTSW 15 102,412,287 (GRCm39) missense probably damaging 1.00
R1844:Map3k12 UTSW 15 102,411,970 (GRCm39) missense probably damaging 1.00
R1880:Map3k12 UTSW 15 102,410,499 (GRCm39) critical splice donor site probably null
R2292:Map3k12 UTSW 15 102,408,574 (GRCm39) missense probably damaging 0.96
R4406:Map3k12 UTSW 15 102,413,837 (GRCm39) missense probably damaging 1.00
R4407:Map3k12 UTSW 15 102,413,837 (GRCm39) missense probably damaging 1.00
R4408:Map3k12 UTSW 15 102,413,837 (GRCm39) missense probably damaging 1.00
R4731:Map3k12 UTSW 15 102,409,717 (GRCm39) missense probably benign 0.28
R5074:Map3k12 UTSW 15 102,410,267 (GRCm39) critical splice donor site probably null
R5605:Map3k12 UTSW 15 102,412,300 (GRCm39) missense probably benign 0.17
R5848:Map3k12 UTSW 15 102,412,670 (GRCm39) missense possibly damaging 0.66
R6232:Map3k12 UTSW 15 102,412,081 (GRCm39) missense probably damaging 0.99
R6901:Map3k12 UTSW 15 102,409,065 (GRCm39) missense possibly damaging 0.65
R6901:Map3k12 UTSW 15 102,409,064 (GRCm39) missense possibly damaging 0.95
R6946:Map3k12 UTSW 15 102,413,569 (GRCm39) missense possibly damaging 0.89
R7291:Map3k12 UTSW 15 102,410,601 (GRCm39) missense probably damaging 1.00
R7874:Map3k12 UTSW 15 102,409,077 (GRCm39) missense possibly damaging 0.91
R8331:Map3k12 UTSW 15 102,410,766 (GRCm39) nonsense probably null
R8460:Map3k12 UTSW 15 102,410,032 (GRCm39) missense probably damaging 1.00
R8784:Map3k12 UTSW 15 102,413,797 (GRCm39) missense possibly damaging 0.51
Predicted Primers PCR Primer
(F):5'- TAGCACTTGGACCCATGAGG -3'
(R):5'- CCTTCTACTCCGAAAGATGTCATC -3'

Sequencing Primer
(F):5'- TGTGGGGTAGAAGAACATCCCC -3'
(R):5'- GATGTCATCATCATCCCCAGACCTG -3'
Posted On 2015-07-06