Incidental Mutation 'R2448:Adamtsl3'
ID248925
Institutional Source Beutler Lab
Gene Symbol Adamtsl3
Ensembl Gene ENSMUSG00000070469
Gene NameADAMTS-like 3
Synonymspunctin-2, 9230119C12Rik
Accession Numbers

NCBI RefSeq: NM_001001322.2; MGI:2685556

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2448 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location82335694-82614450 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 82499748 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Asparagine at position 330 (I330N)
Ref Sequence ENSEMBL: ENSMUSP00000133637 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000173287] [ENSMUST00000173828]
Predicted Effect probably damaging
Transcript: ENSMUST00000173287
AA Change: I330N

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000133637
Gene: ENSMUSG00000070469
AA Change: I330N

DomainStartEndE-ValueType
signal peptide 1 38 N/A INTRINSIC
TSP1 90 136 6.43e-8 SMART
TSP1 355 414 1.59e-1 SMART
TSP1 433 492 3.72e-4 SMART
TSP1 494 547 4.28e-4 SMART
TSP1 579 638 1.85e-2 SMART
TSP1 660 717 1.75e-2 SMART
TSP1 719 773 3.45e-8 SMART
TSP1 775 833 3.67e-3 SMART
TSP1 836 894 8.99e-2 SMART
IGc2 938 1002 7.59e-4 SMART
IG 1213 1296 4.87e0 SMART
IGc2 1326 1388 1.01e-13 SMART
TSP1 1441 1498 1.95e-2 SMART
TSP1 1500 1559 6.76e-2 SMART
TSP1 1616 1666 3.84e-1 SMART
Pfam:PLAC 1674 1704 2.4e-11 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000173828
SMART Domains Protein: ENSMUSP00000133337
Gene: ENSMUSG00000070469

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
Blast:IG 22 79 1e-26 BLAST
SCOP:d1biha4 27 77 2e-5 SMART
IG 283 366 4.87e0 SMART
IGc2 396 458 1.01e-13 SMART
TSP1 511 568 1.95e-2 SMART
TSP1 570 629 6.76e-2 SMART
TSP1 686 736 3.84e-1 SMART
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.3%
Validation Efficiency
MGI Phenotype Strain: 3605825
Homozygous mutation of this gene results in thrombocytopenia, decreased survival, and increased susceptibility to developing thrombotic thrombocytopenic purpura after shiga toxin injection. On a different background, mutants are viable and fertile. (SEE BELOW)
Allele List at MGI

All alleles(10) : Targeted(7) Gene trapped(2) Spontaneous(1)

Other mutations in this stock
Total: 19 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Col1a2 G A 6: 4,518,822 probably benign Het
Col6a3 T C 1: 90,813,358 E784G probably damaging Het
Dis3 T C 14: 99,087,412 T528A probably damaging Het
Haus6 A T 4: 86,589,001 C453S possibly damaging Het
Matn4 T A 2: 164,401,850 Q24L probably benign Het
Megf6 A G 4: 154,266,645 probably null Het
Mut T C 17: 40,958,841 V697A probably damaging Het
Nectin3 A T 16: 46,448,515 probably null Het
Nell1 T A 7: 50,856,387 W781R probably damaging Het
Nrap C T 19: 56,322,030 R1511Q possibly damaging Het
Nup160 C T 2: 90,722,057 R1126W probably damaging Het
Phldb2 T C 16: 45,825,363 Y240C probably damaging Het
Pitpnm2 A G 5: 124,123,994 L874P probably damaging Het
Pole A G 5: 110,297,092 E438G probably damaging Het
Rbm33 A G 5: 28,342,417 Y195C probably benign Het
Robo4 C T 9: 37,402,662 P70S possibly damaging Het
Sdsl T C 5: 120,458,381 K323E probably benign Het
Stag1 T A 9: 100,888,409 V666E probably benign Het
Tns2 C T 15: 102,108,934 R281C probably damaging Het
Other mutations in Adamtsl3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01549:Adamtsl3 APN 7 82612448 missense probably damaging 1.00
IGL01936:Adamtsl3 APN 7 82595371 missense possibly damaging 0.93
IGL02819:Adamtsl3 APN 7 82574121 missense probably damaging 0.99
P0012:Adamtsl3 UTSW 7 82574257 missense probably benign 0.27
R0096:Adamtsl3 UTSW 7 82465699 intron probably benign
R0096:Adamtsl3 UTSW 7 82465699 intron probably benign
R0180:Adamtsl3 UTSW 7 82575990 missense probably benign 0.00
R0270:Adamtsl3 UTSW 7 82556824 missense probably damaging 1.00
R0295:Adamtsl3 UTSW 7 82548005 critical splice donor site probably null
R0329:Adamtsl3 UTSW 7 82521990 missense probably damaging 1.00
R0330:Adamtsl3 UTSW 7 82521990 missense probably damaging 1.00
R0548:Adamtsl3 UTSW 7 82528983 critical splice donor site probably null
R0611:Adamtsl3 UTSW 7 82528912 missense probably damaging 1.00
R0671:Adamtsl3 UTSW 7 82523182 missense probably damaging 1.00
R0711:Adamtsl3 UTSW 7 82465699 intron probably benign
R0845:Adamtsl3 UTSW 7 82575996 missense probably damaging 1.00
R1119:Adamtsl3 UTSW 7 82540317 missense probably damaging 0.96
R1458:Adamtsl3 UTSW 7 82523320 missense probably damaging 1.00
R1644:Adamtsl3 UTSW 7 82450090 missense possibly damaging 0.87
R1691:Adamtsl3 UTSW 7 82499606 missense probably damaging 1.00
R1838:Adamtsl3 UTSW 7 82493373 missense probably damaging 1.00
R2131:Adamtsl3 UTSW 7 82578594 missense probably damaging 1.00
R2245:Adamtsl3 UTSW 7 82450100 missense probably damaging 1.00
R2274:Adamtsl3 UTSW 7 82606558 missense probably benign 0.37
R2275:Adamtsl3 UTSW 7 82606558 missense probably benign 0.37
R3725:Adamtsl3 UTSW 7 82612404 missense possibly damaging 0.80
R3757:Adamtsl3 UTSW 7 82337207 missense probably benign 0.01
R3821:Adamtsl3 UTSW 7 82606479 splice site probably benign
R4618:Adamtsl3 UTSW 7 82606520 missense probably benign 0.41
R4842:Adamtsl3 UTSW 7 82528861 missense probably damaging 1.00
R4887:Adamtsl3 UTSW 7 82574614 missense possibly damaging 0.87
R4888:Adamtsl3 UTSW 7 82574614 missense possibly damaging 0.87
R4925:Adamtsl3 UTSW 7 82602299 critical splice donor site probably null
R4960:Adamtsl3 UTSW 7 82566977 missense probably damaging 0.99
R5026:Adamtsl3 UTSW 7 82576054 missense probably benign 0.07
R5152:Adamtsl3 UTSW 7 82574544 missense probably benign 0.11
R5198:Adamtsl3 UTSW 7 82611798 missense possibly damaging 0.63
R5244:Adamtsl3 UTSW 7 82598069 missense probably benign 0.02
R5281:Adamtsl3 UTSW 7 82528934 missense probably damaging 1.00
R5323:Adamtsl3 UTSW 7 82557061 missense probably damaging 1.00
R5523:Adamtsl3 UTSW 7 82574442 missense possibly damaging 0.86
R5602:Adamtsl3 UTSW 7 82557239 missense possibly damaging 0.89
R5638:Adamtsl3 UTSW 7 82611750 missense probably damaging 0.99
R5682:Adamtsl3 UTSW 7 82606550 missense probably damaging 0.99
R5782:Adamtsl3 UTSW 7 82540286 intron probably null
R5946:Adamtsl3 UTSW 7 82576057 missense probably damaging 0.98
R6091:Adamtsl3 UTSW 7 82465621 missense probably damaging 1.00
R6258:Adamtsl3 UTSW 7 82528983 critical splice donor site probably null
R6500:Adamtsl3 UTSW 7 82578610 missense probably benign 0.00
R6765:Adamtsl3 UTSW 7 82567024 missense possibly damaging 0.60
R6785:Adamtsl3 UTSW 7 82522004 missense probably damaging 0.99
R6982:Adamtsl3 UTSW 7 82515063 missense probably damaging 1.00
R7109:Adamtsl3 UTSW 7 82611861 missense
R7341:Adamtsl3 UTSW 7 82556874 missense probably damaging 1.00
R7402:Adamtsl3 UTSW 7 82578617 missense probably damaging 0.96
R7506:Adamtsl3 UTSW 7 82514978 missense probably damaging 1.00
R7549:Adamtsl3 UTSW 7 82573909 missense probably damaging 1.00
R7575:Adamtsl3 UTSW 7 82574548 missense possibly damaging 0.85
R7592:Adamtsl3 UTSW 7 82337251 missense probably benign 0.00
R7654:Adamtsl3 UTSW 7 82574494 missense probably benign
R7721:Adamtsl3 UTSW 7 82606520 missense possibly damaging 0.62
R7784:Adamtsl3 UTSW 7 82573989 missense probably damaging 1.00
R7858:Adamtsl3 UTSW 7 82450163 missense probably damaging 1.00
R7941:Adamtsl3 UTSW 7 82450163 missense probably damaging 1.00
RF005:Adamtsl3 UTSW 7 82612395 missense
X0003:Adamtsl3 UTSW 7 82611759 nonsense probably null
X0063:Adamtsl3 UTSW 7 82574157 missense probably benign 0.25
Z1088:Adamtsl3 UTSW 7 82499714 missense probably damaging 1.00
Z1088:Adamtsl3 UTSW 7 82540325 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCTGCACTTAGCCATTGTATCG -3'
(R):5'- GACTTAAACTGAGCATGGCACG -3'

Sequencing Primer
(F):5'- AATCAAATGTCTTTAGGGTAGTTCC -3'
(R):5'- GAATATGAAGTTATCTCCCCCTGG -3'
Posted On2014-11-12