Incidental Mutation 'R2443:Pnpla2'
ID249871
Institutional Source Beutler Lab
Gene Symbol Pnpla2
Ensembl Gene ENSMUSG00000025509
Gene Namepatatin-like phospholipase domain containing 2
SynonymsAtgl, 0610039C21Rik, 1110001C14Rik, desnutrin
MMRRC Submission 040401-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.364) question?
Stock #R2443 (G1)
Quality Score220
Status Not validated
Chromosome7
Chromosomal Location141455198-141460743 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 141458069 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 184 (V184A)
Ref Sequence ENSEMBL: ENSMUSP00000127149 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026583] [ENSMUST00000053670] [ENSMUST00000064151] [ENSMUST00000164016] [ENSMUST00000164924] [ENSMUST00000165194] [ENSMUST00000165487] [ENSMUST00000167491] [ENSMUST00000169665]
Predicted Effect probably benign
Transcript: ENSMUST00000026583
SMART Domains Protein: ENSMUSP00000026583
Gene: ENSMUSG00000025509

DomainStartEndE-ValueType
Pfam:Patatin 10 69 4.5e-11 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000053670
SMART Domains Protein: ENSMUSP00000055899
Gene: ENSMUSG00000048200

DomainStartEndE-ValueType
low complexity region 3 20 N/A INTRINSIC
EFh 32 60 2.71e0 SMART
EFh 66 94 2.63e0 SMART
low complexity region 108 126 N/A INTRINSIC
coiled coil region 167 312 N/A INTRINSIC
low complexity region 324 346 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000064151
AA Change: V184A

PolyPhen 2 Score 0.730 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000065116
Gene: ENSMUSG00000025509
AA Change: V184A

DomainStartEndE-ValueType
Pfam:Patatin 10 179 1.8e-15 PFAM
low complexity region 409 425 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000097947
Predicted Effect noncoding transcript
Transcript: ENSMUST00000163674
Predicted Effect possibly damaging
Transcript: ENSMUST00000164016
AA Change: V184A

PolyPhen 2 Score 0.730 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000127149
Gene: ENSMUSG00000025509
AA Change: V184A

DomainStartEndE-ValueType
Pfam:Patatin 10 179 3.3e-15 PFAM
low complexity region 243 287 N/A INTRINSIC
low complexity region 465 481 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000164924
SMART Domains Protein: ENSMUSP00000129632
Gene: ENSMUSG00000025509

DomainStartEndE-ValueType
Pfam:Patatin 10 69 4.5e-11 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000165194
Predicted Effect probably benign
Transcript: ENSMUST00000165487
AA Change: V131A

PolyPhen 2 Score 0.163 (Sensitivity: 0.92; Specificity: 0.87)
Predicted Effect probably benign
Transcript: ENSMUST00000167491
SMART Domains Protein: ENSMUSP00000127957
Gene: ENSMUSG00000048200

DomainStartEndE-ValueType
low complexity region 3 20 N/A INTRINSIC
EFh 32 60 2.71e0 SMART
EFh 66 94 2.63e0 SMART
low complexity region 108 126 N/A INTRINSIC
coiled coil region 167 219 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000167900
Predicted Effect probably benign
Transcript: ENSMUST00000169665
SMART Domains Protein: ENSMUSP00000127983
Gene: ENSMUSG00000025509

DomainStartEndE-ValueType
Pfam:Patatin 10 249 3.4e-11 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000211564
Predicted Effect noncoding transcript
Transcript: ENSMUST00000169723
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an enzyme which catalyzes the first step in the hydrolysis of triglycerides in adipose tissue. Mutations in this gene are associated with neutral lipid storage disease with myopathy. [provided by RefSeq, Jul 2010]
PHENOTYPE: Mice homozygous for this targeted mutation have defects in lipolysis and altered energy metabolism. Triglyceride accumulation in cardiac muscle leads to severe cardiac dysfunction and mortality. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5330417C22Rik A T 3: 108,481,349 N239K probably damaging Het
Anapc13 C T 9: 102,634,023 P37S probably damaging Het
Asxl3 T A 18: 22,411,539 D39E probably benign Het
Clec4d G A 6: 123,268,117 V119M probably benign Het
Dlx2 A G 2: 71,546,005 S130P probably benign Het
Dync2li1 C A 17: 84,647,665 Q251K probably benign Het
E330009J07Rik T C 6: 40,406,776 D444G probably damaging Het
Edem1 A T 6: 108,851,269 K518N probably benign Het
Fbln2 T C 6: 91,259,711 V736A probably damaging Het
Fga A G 3: 83,028,541 K25R probably benign Het
Hmcn1 C A 1: 150,599,032 R4701S probably benign Het
Ighv8-5 G A 12: 115,067,820 P33L probably damaging Het
Kcnip3 T A 2: 127,460,063 I194F probably damaging Het
Kif26b A C 1: 178,915,014 I892L probably damaging Het
Krt78 C T 15: 101,946,598 G926E probably damaging Het
Maats1 A G 16: 38,302,732 Y645H probably damaging Het
Map1b T C 13: 99,430,411 Y1934C unknown Het
Masp1 A T 16: 23,476,312 Y400N probably damaging Het
Methig1 T C 15: 100,353,211 M1T probably null Het
Mmp19 A G 10: 128,798,856 E447G possibly damaging Het
Ms4a6d G A 19: 11,590,193 H115Y possibly damaging Het
Myo1e C T 9: 70,327,172 S269L probably benign Het
Myo7a G A 7: 98,095,769 T288I probably benign Het
Npy5r T A 8: 66,681,290 K284* probably null Het
Oas3 C A 5: 120,777,488 R46L probably benign Het
Olfr1157 A T 2: 87,962,865 V9E possibly damaging Het
Pkd1l3 T A 8: 109,623,815 S431T probably benign Het
Pomt2 C A 12: 87,133,380 K282N probably damaging Het
Psmd12 T A 11: 107,495,737 M378K probably damaging Het
Sla2 G A 2: 156,875,942 R137C probably damaging Het
Strn3 A T 12: 51,627,835 Y389N probably damaging Het
Tdrd1 C T 19: 56,841,354 A220V probably null Het
Tecpr2 T G 12: 110,896,325 L57R probably damaging Het
Tkfc A G 19: 10,594,538 L378P probably damaging Het
Tmprss2 T G 16: 97,568,503 D357A possibly damaging Het
Tollip C T 7: 141,890,823 W64* probably null Het
Vcan A G 13: 89,704,675 F722S probably damaging Het
Vcp A T 4: 42,983,385 N558K probably damaging Het
Vmn1r232 A G 17: 20,913,384 I318T probably damaging Het
Vmn1r33 A T 6: 66,611,973 I199K possibly damaging Het
Zfp61 A G 7: 24,291,769 V319A probably benign Het
Zfyve28 A G 5: 34,216,894 V592A possibly damaging Het
Other mutations in Pnpla2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02267:Pnpla2 APN 7 141458209 missense probably damaging 1.00
IGL02622:Pnpla2 APN 7 141455372 missense probably damaging 1.00
R0334:Pnpla2 UTSW 7 141459520 splice site probably null
R1145:Pnpla2 UTSW 7 141455416 missense probably damaging 1.00
R1145:Pnpla2 UTSW 7 141455416 missense probably damaging 1.00
R1171:Pnpla2 UTSW 7 141458881 missense probably benign 0.05
R1435:Pnpla2 UTSW 7 141457411 missense probably benign 0.00
R1774:Pnpla2 UTSW 7 141459568 missense probably damaging 0.96
R1866:Pnpla2 UTSW 7 141455416 missense probably damaging 1.00
R1967:Pnpla2 UTSW 7 141459432 missense probably benign 0.21
R2153:Pnpla2 UTSW 7 141459219 missense probably damaging 1.00
R2923:Pnpla2 UTSW 7 141455467 missense probably benign 0.15
R2964:Pnpla2 UTSW 7 141458478 missense probably damaging 1.00
R2966:Pnpla2 UTSW 7 141458478 missense probably damaging 1.00
R4576:Pnpla2 UTSW 7 141457344 missense probably damaging 1.00
R4577:Pnpla2 UTSW 7 141457344 missense probably damaging 1.00
R4646:Pnpla2 UTSW 7 141458661 missense possibly damaging 0.69
R4677:Pnpla2 UTSW 7 141458443 missense probably damaging 1.00
R4934:Pnpla2 UTSW 7 141458172 missense probably damaging 1.00
R5011:Pnpla2 UTSW 7 141459291 critical splice donor site probably null
R5334:Pnpla2 UTSW 7 141459493 missense probably damaging 0.97
R6331:Pnpla2 UTSW 7 141459285 missense probably damaging 0.99
R7361:Pnpla2 UTSW 7 141457431 missense possibly damaging 0.77
R7959:Pnpla2 UTSW 7 141457493 missense probably benign 0.00
R8066:Pnpla2 UTSW 7 141459668 makesense probably null
R8354:Pnpla2 UTSW 7 141458098 missense probably damaging 1.00
R8454:Pnpla2 UTSW 7 141458098 missense probably damaging 1.00
X0020:Pnpla2 UTSW 7 141459660 missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- TCTTGGGGAGGCTCAGATTTCC -3'
(R):5'- TGCTGGCTTAGTCAGGACTG -3'

Sequencing Primer
(F):5'- ATTTGCTGAGGAGTCCCCAG -3'
(R):5'- CTTAGTCAGGACTGGGTGTGTGC -3'
Posted On2014-11-12