Incidental Mutation 'R2443:Tdrd1'
ID249895
Institutional Source Beutler Lab
Gene Symbol Tdrd1
Ensembl Gene ENSMUSG00000025081
Gene Nametudor domain containing 1
SynonymsMTR-1
MMRRC Submission 040401-MU
Accession Numbers

Genbank: NM_001002238

Is this an essential gene? Possibly essential (E-score: 0.502) question?
Stock #R2443 (G1)
Quality Score225
Status Not validated
Chromosome19
Chromosomal Location56826209-56870012 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 56841354 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Valine at position 220 (A220V)
Ref Sequence ENSEMBL: ENSMUSP00000112786 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000078723] [ENSMUST00000111604] [ENSMUST00000111606] [ENSMUST00000121249]
Predicted Effect probably null
Transcript: ENSMUST00000078723
AA Change: A220V

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000077785
Gene: ENSMUSG00000025081
AA Change: A220V

DomainStartEndE-ValueType
low complexity region 75 86 N/A INTRINSIC
low complexity region 103 117 N/A INTRINSIC
Pfam:zf-MYND 163 199 3.5e-13 PFAM
TUDOR 306 365 6.45e-11 SMART
TUDOR 537 593 4.88e-11 SMART
low complexity region 698 714 N/A INTRINSIC
low complexity region 728 739 N/A INTRINSIC
TUDOR 755 813 3.97e-11 SMART
TUDOR 981 1038 1.27e-9 SMART
Predicted Effect probably null
Transcript: ENSMUST00000111604
AA Change: A220V

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000107231
Gene: ENSMUSG00000025081
AA Change: A220V

DomainStartEndE-ValueType
low complexity region 75 86 N/A INTRINSIC
low complexity region 103 117 N/A INTRINSIC
Pfam:zf-MYND 163 199 3.5e-13 PFAM
TUDOR 306 365 6.45e-11 SMART
TUDOR 537 593 4.88e-11 SMART
low complexity region 698 714 N/A INTRINSIC
low complexity region 728 739 N/A INTRINSIC
TUDOR 755 813 3.97e-11 SMART
TUDOR 981 1038 1.27e-9 SMART
Predicted Effect probably null
Transcript: ENSMUST00000111606
AA Change: A220V

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000107233
Gene: ENSMUSG00000025081
AA Change: A220V

DomainStartEndE-ValueType
low complexity region 75 86 N/A INTRINSIC
low complexity region 103 117 N/A INTRINSIC
Pfam:zf-MYND 163 199 3.5e-13 PFAM
TUDOR 306 365 6.45e-11 SMART
TUDOR 537 593 4.88e-11 SMART
low complexity region 698 714 N/A INTRINSIC
low complexity region 728 739 N/A INTRINSIC
TUDOR 755 813 3.97e-11 SMART
TUDOR 981 1038 1.27e-9 SMART
Predicted Effect probably null
Transcript: ENSMUST00000121249
AA Change: A220V

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000112786
Gene: ENSMUSG00000025081
AA Change: A220V

DomainStartEndE-ValueType
low complexity region 75 86 N/A INTRINSIC
low complexity region 103 117 N/A INTRINSIC
Pfam:zf-MYND 163 199 9.9e-13 PFAM
TUDOR 306 365 6.45e-11 SMART
TUDOR 537 593 4.88e-11 SMART
low complexity region 698 714 N/A INTRINSIC
low complexity region 728 739 N/A INTRINSIC
TUDOR 755 813 3.97e-11 SMART
TUDOR 981 1038 1.27e-9 SMART
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is similar to a mouse gene that encodes a tudor domain protein. Alternatively spliced transcript variants have been described but their full length sequences have not been determined. [provided by RefSeq, Jul 2008]
PHENOTYPE: Male homozygous mice are sterile, displaying postnatal spermatogenic defects. Females are fertile. [provided by MGI curators]
Allele List at MGI

 All alleles(3) : Targeted, knock-out(1) Targeted, other(2)

Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5330417C22Rik A T 3: 108,481,349 N239K probably damaging Het
Anapc13 C T 9: 102,634,023 P37S probably damaging Het
Asxl3 T A 18: 22,411,539 D39E probably benign Het
Clec4d G A 6: 123,268,117 V119M probably benign Het
Dlx2 A G 2: 71,546,005 S130P probably benign Het
Dync2li1 C A 17: 84,647,665 Q251K probably benign Het
E330009J07Rik T C 6: 40,406,776 D444G probably damaging Het
Edem1 A T 6: 108,851,269 K518N probably benign Het
Fbln2 T C 6: 91,259,711 V736A probably damaging Het
Fga A G 3: 83,028,541 K25R probably benign Het
Hmcn1 C A 1: 150,599,032 R4701S probably benign Het
Ighv8-5 G A 12: 115,067,820 P33L probably damaging Het
Kcnip3 T A 2: 127,460,063 I194F probably damaging Het
Kif26b A C 1: 178,915,014 I892L probably damaging Het
Krt78 C T 15: 101,946,598 G926E probably damaging Het
Maats1 A G 16: 38,302,732 Y645H probably damaging Het
Map1b T C 13: 99,430,411 Y1934C unknown Het
Masp1 A T 16: 23,476,312 Y400N probably damaging Het
Methig1 T C 15: 100,353,211 M1T probably null Het
Mmp19 A G 10: 128,798,856 E447G possibly damaging Het
Ms4a6d G A 19: 11,590,193 H115Y possibly damaging Het
Myo1e C T 9: 70,327,172 S269L probably benign Het
Myo7a G A 7: 98,095,769 T288I probably benign Het
Npy5r T A 8: 66,681,290 K284* probably null Het
Oas3 C A 5: 120,777,488 R46L probably benign Het
Olfr1157 A T 2: 87,962,865 V9E possibly damaging Het
Pkd1l3 T A 8: 109,623,815 S431T probably benign Het
Pnpla2 T C 7: 141,458,069 V184A possibly damaging Het
Pomt2 C A 12: 87,133,380 K282N probably damaging Het
Psmd12 T A 11: 107,495,737 M378K probably damaging Het
Sla2 G A 2: 156,875,942 R137C probably damaging Het
Strn3 A T 12: 51,627,835 Y389N probably damaging Het
Tecpr2 T G 12: 110,896,325 L57R probably damaging Het
Tkfc A G 19: 10,594,538 L378P probably damaging Het
Tmprss2 T G 16: 97,568,503 D357A possibly damaging Het
Tollip C T 7: 141,890,823 W64* probably null Het
Vcan A G 13: 89,704,675 F722S probably damaging Het
Vcp A T 4: 42,983,385 N558K probably damaging Het
Vmn1r232 A G 17: 20,913,384 I318T probably damaging Het
Vmn1r33 A T 6: 66,611,973 I199K possibly damaging Het
Zfp61 A G 7: 24,291,769 V319A probably benign Het
Zfyve28 A G 5: 34,216,894 V592A possibly damaging Het
Other mutations in Tdrd1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00423:Tdrd1 APN 19 56851464 missense possibly damaging 0.51
IGL01366:Tdrd1 APN 19 56855302 missense probably benign 0.00
IGL01569:Tdrd1 APN 19 56834409 missense probably damaging 1.00
IGL02691:Tdrd1 APN 19 56843852 missense probably damaging 0.99
3-1:Tdrd1 UTSW 19 56861695 missense probably benign
R0081:Tdrd1 UTSW 19 56831271 missense probably benign 0.16
R0139:Tdrd1 UTSW 19 56843198 missense probably benign 0.00
R0254:Tdrd1 UTSW 19 56842566 missense probably benign 0.02
R0686:Tdrd1 UTSW 19 56856051 missense probably damaging 1.00
R0735:Tdrd1 UTSW 19 56865978 nonsense probably null
R0740:Tdrd1 UTSW 19 56839099 missense probably damaging 1.00
R1241:Tdrd1 UTSW 19 56861760 missense probably benign
R1294:Tdrd1 UTSW 19 56848776 splice site probably null
R1508:Tdrd1 UTSW 19 56851358 missense probably damaging 1.00
R1655:Tdrd1 UTSW 19 56843216 nonsense probably null
R1708:Tdrd1 UTSW 19 56842289 missense probably benign 0.13
R1796:Tdrd1 UTSW 19 56837783 missense probably damaging 0.98
R1840:Tdrd1 UTSW 19 56842312 missense probably damaging 1.00
R2138:Tdrd1 UTSW 19 56842589 missense probably benign 0.30
R2201:Tdrd1 UTSW 19 56858661 missense probably benign 0.14
R2201:Tdrd1 UTSW 19 56858662 missense probably benign 0.00
R2286:Tdrd1 UTSW 19 56839119 missense probably benign 0.05
R3001:Tdrd1 UTSW 19 56861750 nonsense probably null
R3002:Tdrd1 UTSW 19 56861750 nonsense probably null
R3418:Tdrd1 UTSW 19 56831231 missense possibly damaging 0.87
R3419:Tdrd1 UTSW 19 56831231 missense possibly damaging 0.87
R3707:Tdrd1 UTSW 19 56865993 missense possibly damaging 0.86
R3978:Tdrd1 UTSW 19 56866634 missense probably benign 0.01
R4077:Tdrd1 UTSW 19 56831073 missense probably benign 0.22
R4083:Tdrd1 UTSW 19 56843230 missense probably benign
R4193:Tdrd1 UTSW 19 56851341 nonsense probably null
R5882:Tdrd1 UTSW 19 56848939 missense probably damaging 1.00
R6073:Tdrd1 UTSW 19 56843223 nonsense probably null
R6223:Tdrd1 UTSW 19 56865850 missense probably damaging 1.00
R6240:Tdrd1 UTSW 19 56841335 missense probably benign 0.00
R6953:Tdrd1 UTSW 19 56831371 missense probably damaging 0.98
R7090:Tdrd1 UTSW 19 56851401 missense probably benign 0.28
R7643:Tdrd1 UTSW 19 56837708 missense probably damaging 1.00
R7793:Tdrd1 UTSW 19 56864377 missense probably damaging 0.99
R7972:Tdrd1 UTSW 19 56848702 missense probably damaging 0.98
R8076:Tdrd1 UTSW 19 56843835 missense probably damaging 0.96
R8346:Tdrd1 UTSW 19 56842267 missense probably benign 0.44
R8400:Tdrd1 UTSW 19 56848649 missense probably benign 0.05
X0020:Tdrd1 UTSW 19 56856060 missense probably damaging 1.00
X0053:Tdrd1 UTSW 19 56865791 missense possibly damaging 0.85
Predicted Primers PCR Primer
(F):5'- TCATGGCAAGTCAGGGCTAC -3'
(R):5'- CTGGCTCAAGGACATTTTGGG -3'

Sequencing Primer
(F):5'- AGGGCTACTGTTCTCCACACG -3'
(R):5'- CTCAAGGACATTTTGGGGAAAGATTG -3'
Posted On2014-11-12