Incidental Mutation 'R0322:Srrt'
ID25607
Institutional Source Beutler Lab
Gene Symbol Srrt
Ensembl Gene ENSMUSG00000037364
Gene Nameserrate RNA effector molecule homolog (Arabidopsis)
Synonyms2810019G02Rik, Asr2, Ars2
MMRRC Submission 038532-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0322 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location137295704-137307674 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 137296608 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Cysteine at position 370 (R370C)
Ref Sequence ENSEMBL: ENSMUSP00000142351 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000024099] [ENSMUST00000040873] [ENSMUST00000052825] [ENSMUST00000085934] [ENSMUST00000196109] [ENSMUST00000196208] [ENSMUST00000197466] [ENSMUST00000198526] [ENSMUST00000199243]
Predicted Effect probably benign
Transcript: ENSMUST00000024099
SMART Domains Protein: ENSMUSP00000024099
Gene: ENSMUSG00000023328

DomainStartEndE-ValueType
Pfam:COesterase 14 563 2e-186 PFAM
Pfam:Abhydrolase_3 146 276 7.5e-9 PFAM
Pfam:AChE_tetra 578 614 3.2e-26 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000040873
AA Change: R728C

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000043123
Gene: ENSMUSG00000037364
AA Change: R728C

DomainStartEndE-ValueType
low complexity region 3 65 N/A INTRINSIC
low complexity region 95 116 N/A INTRINSIC
Pfam:DUF3546 153 262 3.8e-44 PFAM
low complexity region 269 276 N/A INTRINSIC
low complexity region 326 350 N/A INTRINSIC
coiled coil region 367 402 N/A INTRINSIC
Blast:RRM 421 491 2e-31 BLAST
low complexity region 566 595 N/A INTRINSIC
low complexity region 603 615 N/A INTRINSIC
Pfam:ARS2 645 850 9.7e-94 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000052825
SMART Domains Protein: ENSMUSP00000056156
Gene: ENSMUSG00000051502

DomainStartEndE-ValueType
Pfam:Peptidase_C78 27 212 5.4e-37 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000085934
SMART Domains Protein: ENSMUSP00000083097
Gene: ENSMUSG00000023328

DomainStartEndE-ValueType
Pfam:COesterase 15 563 3e-178 PFAM
Pfam:Abhydrolase_3 146 260 1.4e-7 PFAM
Pfam:AChE_tetra 578 613 3.2e-23 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150983
Predicted Effect noncoding transcript
Transcript: ENSMUST00000184134
Predicted Effect noncoding transcript
Transcript: ENSMUST00000184197
Predicted Effect probably damaging
Transcript: ENSMUST00000196109
AA Change: R370C

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000142351
Gene: ENSMUSG00000037364
AA Change: R370C

DomainStartEndE-ValueType
coiled coil region 11 46 N/A INTRINSIC
Blast:RRM 65 133 2e-15 BLAST
low complexity region 208 237 N/A INTRINSIC
low complexity region 245 257 N/A INTRINSIC
Pfam:ARS2 277 498 6.5e-111 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000196208
SMART Domains Protein: ENSMUSP00000142427
Gene: ENSMUSG00000023328

DomainStartEndE-ValueType
Pfam:COesterase 14 359 6.5e-134 PFAM
Pfam:Abhydrolase_3 146 284 4.1e-7 PFAM
Pfam:COesterase 355 475 1.5e-25 PFAM
Pfam:AChE_tetra 490 526 2.2e-23 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000196394
Predicted Effect noncoding transcript
Transcript: ENSMUST00000196576
Predicted Effect noncoding transcript
Transcript: ENSMUST00000196960
Predicted Effect noncoding transcript
Transcript: ENSMUST00000197144
Predicted Effect noncoding transcript
Transcript: ENSMUST00000197376
Predicted Effect noncoding transcript
Transcript: ENSMUST00000197409
Predicted Effect probably damaging
Transcript: ENSMUST00000197466
AA Change: R728C

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000142564
Gene: ENSMUSG00000037364
AA Change: R728C

DomainStartEndE-ValueType
low complexity region 3 65 N/A INTRINSIC
low complexity region 95 116 N/A INTRINSIC
Pfam:DUF3546 151 264 9.5e-48 PFAM
low complexity region 269 276 N/A INTRINSIC
low complexity region 326 350 N/A INTRINSIC
coiled coil region 367 402 N/A INTRINSIC
Blast:RRM 421 491 2e-31 BLAST
low complexity region 566 595 N/A INTRINSIC
low complexity region 603 615 N/A INTRINSIC
Pfam:ARS2 635 845 5.5e-113 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000198526
SMART Domains Protein: ENSMUSP00000142435
Gene: ENSMUSG00000037364

DomainStartEndE-ValueType
low complexity region 3 65 N/A INTRINSIC
low complexity region 95 116 N/A INTRINSIC
Pfam:DUF3546 151 264 2e-45 PFAM
low complexity region 269 276 N/A INTRINSIC
low complexity region 322 347 N/A INTRINSIC
low complexity region 369 408 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000199243
AA Change: R728C

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000143232
Gene: ENSMUSG00000037364
AA Change: R728C

DomainStartEndE-ValueType
low complexity region 3 65 N/A INTRINSIC
low complexity region 95 116 N/A INTRINSIC
Pfam:DUF3546 151 264 9.5e-48 PFAM
low complexity region 269 276 N/A INTRINSIC
low complexity region 326 350 N/A INTRINSIC
coiled coil region 367 402 N/A INTRINSIC
Blast:RRM 421 491 2e-31 BLAST
low complexity region 566 595 N/A INTRINSIC
low complexity region 603 615 N/A INTRINSIC
Pfam:ARS2 635 849 9.8e-115 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000199365
Predicted Effect noncoding transcript
Transcript: ENSMUST00000199473
Predicted Effect probably benign
Transcript: ENSMUST00000199605
Predicted Effect unknown
Transcript: ENSMUST00000199756
AA Change: R150C
Predicted Effect noncoding transcript
Transcript: ENSMUST00000200643
Predicted Effect probably benign
Transcript: ENSMUST00000223263
Meta Mutation Damage Score 0.5620 question?
Coding Region Coverage
  • 1x: 98.7%
  • 3x: 97.5%
  • 10x: 93.8%
  • 20x: 84.3%
Validation Efficiency 98% (58/59)
MGI Phenotype PHENOTYPE: Mice homozygous for a null allele display embryonic lethality before somite formation, increased apoptosis, and when cultured most fail to hatch from the zona pellucida. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9130401M01Rik A T 15: 58,025,372 S275T possibly damaging Het
Adam34 G T 8: 43,651,921 T229N probably benign Het
Adgrb3 C A 1: 25,221,748 probably benign Het
Ankhd1 T A 18: 36,658,008 Y2478* probably null Het
Arl9 A G 5: 77,007,190 probably benign Het
Bub1b G A 2: 118,639,618 probably benign Het
Chl1 A T 6: 103,701,883 probably benign Het
Cobl T A 11: 12,267,072 E465V probably damaging Het
Cobll1 A T 2: 65,102,098 M520K possibly damaging Het
Dll3 A G 7: 28,296,368 V336A possibly damaging Het
Dnmbp T C 19: 43,854,846 H1193R probably damaging Het
Fbxo43 T C 15: 36,152,192 probably benign Het
Gart G A 16: 91,623,037 probably benign Het
Gjc3 A T 5: 137,957,498 M175K possibly damaging Het
Gm9008 T C 6: 76,496,418 Y405C probably benign Het
Gpc5 T A 14: 115,399,151 N415K probably benign Het
Idh2 C T 7: 80,098,257 A232T probably damaging Het
Il7r A T 15: 9,510,215 F251I probably benign Het
Insc A G 7: 114,792,265 E141G probably damaging Het
Itm2c C T 1: 85,907,030 T160M probably damaging Het
Mboat1 T C 13: 30,232,080 probably benign Het
Mdm2 G T 10: 117,702,204 H96Q possibly damaging Het
Mettl13 A G 1: 162,544,176 probably benign Het
Mfsd4b3 T C 10: 39,947,530 N245D probably damaging Het
Mroh2a C T 1: 88,230,680 R150* probably null Het
Mtmr3 T C 11: 4,487,505 Y982C possibly damaging Het
Mymk A T 2: 27,067,406 L66Q probably damaging Het
Myo18a T C 11: 77,829,800 S767P probably damaging Het
Ndufa8 T C 2: 36,036,622 D134G probably benign Het
Noxa1 A G 2: 25,092,554 F83S probably damaging Het
Npc1l1 T A 11: 6,229,042 I123L probably benign Het
Ogdhl A G 14: 32,337,577 T394A probably benign Het
Olfr1193 T C 2: 88,678,667 S264P probably damaging Het
Olfr290 A G 7: 84,916,313 Y178C probably damaging Het
Pcdh20 T C 14: 88,468,947 T306A probably benign Het
Pcid2 G A 8: 13,090,775 probably benign Het
Phyhip G A 14: 70,463,396 V108M possibly damaging Het
Pnpla5 G T 15: 84,120,719 L144M probably damaging Het
Psmb4 A G 3: 94,886,091 Y160H probably benign Het
Riox2 A T 16: 59,489,389 K369* probably null Het
Sh3tc1 G A 5: 35,706,561 P761S possibly damaging Het
Slc6a3 T A 13: 73,560,926 V323D possibly damaging Het
Smg7 A G 1: 152,849,873 probably null Het
Stc1 T C 14: 69,029,409 V7A probably benign Het
Svep1 G T 4: 58,057,996 probably benign Het
Tbpl2 A G 2: 24,094,979 V51A probably benign Het
Tecr A G 8: 83,572,243 Y248H probably damaging Het
Tenm3 A G 8: 48,236,912 probably benign Het
Tia1 C T 6: 86,420,387 A114V probably damaging Het
Tmprss11f A T 5: 86,591,416 M2K probably benign Het
Tnfsf8 T C 4: 63,834,166 T221A probably damaging Het
Tubgcp5 G A 7: 55,814,978 G536S probably damaging Het
Tyr A T 7: 87,492,917 I145N probably benign Het
Ubr4 T A 4: 139,422,418 V1809E probably damaging Het
Vmn2r65 A T 7: 84,946,548 N309K probably benign Het
Other mutations in Srrt
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00337:Srrt APN 5 137295978 unclassified probably benign
IGL01062:Srrt APN 5 137296307 missense probably damaging 1.00
IGL02227:Srrt APN 5 137296274 missense probably damaging 1.00
IGL02656:Srrt APN 5 137299676 unclassified probably benign
IGL03105:Srrt APN 5 137299844 missense possibly damaging 0.72
IGL03137:Srrt APN 5 137296117 unclassified probably benign
R0281:Srrt UTSW 5 137296127 unclassified probably benign
R0347:Srrt UTSW 5 137299676 unclassified probably benign
R1253:Srrt UTSW 5 137300336 missense probably benign 0.01
R1397:Srrt UTSW 5 137300261 missense possibly damaging 0.89
R1520:Srrt UTSW 5 137298766 missense probably damaging 0.99
R1561:Srrt UTSW 5 137300019 missense probably benign 0.24
R1645:Srrt UTSW 5 137302139 nonsense probably null
R1759:Srrt UTSW 5 137302950 missense probably damaging 1.00
R1770:Srrt UTSW 5 137299860 unclassified probably benign
R1795:Srrt UTSW 5 137303012 unclassified probably benign
R1848:Srrt UTSW 5 137296945 missense probably damaging 1.00
R3838:Srrt UTSW 5 137302125 critical splice donor site probably null
R5015:Srrt UTSW 5 137296009 missense probably damaging 1.00
R5068:Srrt UTSW 5 137296541 missense possibly damaging 0.93
R5163:Srrt UTSW 5 137296773 critical splice donor site probably null
R5316:Srrt UTSW 5 137296551 missense probably benign 0.16
R5343:Srrt UTSW 5 137297165 missense probably damaging 1.00
R5351:Srrt UTSW 5 137298284 makesense probably null
R5412:Srrt UTSW 5 137296287 missense probably damaging 1.00
R5806:Srrt UTSW 5 137297917 missense probably damaging 0.98
R6470:Srrt UTSW 5 137302656 missense probably damaging 1.00
R6497:Srrt UTSW 5 137297506 missense probably damaging 1.00
R6755:Srrt UTSW 5 137302930 missense probably damaging 1.00
R6828:Srrt UTSW 5 137296968 missense probably damaging 1.00
R6875:Srrt UTSW 5 137298673 missense probably benign 0.00
R7586:Srrt UTSW 5 137302195 missense probably damaging 0.98
R7677:Srrt UTSW 5 137300148 missense probably damaging 0.99
R8027:Srrt UTSW 5 137302499 frame shift probably null
RF018:Srrt UTSW 5 137300000 missense probably benign 0.23
Z1176:Srrt UTSW 5 137298227 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- ATGGCAGCCACCACAGATCGTATC -3'
(R):5'- AGTTTGTCACCTCCAACACGCAG -3'

Sequencing Primer
(F):5'- CAGATCGTATCTTACTCTGGGCAG -3'
(R):5'- CAAGGATAAGTGGCTATGTCCTCTC -3'
Posted On2013-04-16