Mutagenetix > Incidental Mutations

Incidental Mutation 'R3720:Sybu'

258872

Institutional Source

Beutler Lab

Gene Symbol

Sybu

Ensembl Gene

ENSMUSG00000022340

Gene Name

syntabulin (syntaxin-interacting)

Synonyms

A830027B17Rik, Golsyn/Syntabulin, 5730410E15Rik

MMRRC Submission

040711-MU

Accession Numbers

Genbank: NM_176998 ; MGI: 2442392

Is this an essential gene?

Possibly essential (E-score: 0.541) question?

Stock #

R3720 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

44671856-44788063 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 44672632 bp

Zygosity

Heterozygous

Amino Acid Change

Valine to Alanine at position 766 (V766A)

Ref Sequence

ENSEMBL: ENSMUSP00000087511 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000090057] [ENSMUST00000110267] [ENSMUST00000110269] [ENSMUST00000226214] [ENSMUST00000227305] [ENSMUST00000228057]

Predicted Effect

possibly damaging
Transcript: ENSMUST00000090057
AA Change: V766A

PolyPhen 2 Score 0.886 (Sensitivity: 0.82; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000087511
Gene: ENSMUSG00000022340
AA Change: V766A

Domain	Start	End	E-Value	Type
low complexity region	51	61	N/A	INTRINSIC
low complexity region	112	120	N/A	INTRINSIC
low complexity region	148	163	N/A	INTRINSIC
low complexity region	174	205	N/A	INTRINSIC
low complexity region	264	275	N/A	INTRINSIC
low complexity region	276	290	N/A	INTRINSIC
low complexity region	320	331	N/A	INTRINSIC
Pfam:Syntaphilin	343	638	3.5e-142	PFAM
low complexity region	738	755	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000110267
AA Change: V638A

PolyPhen 2 Score 0.577 (Sensitivity: 0.88; Specificity: 0.91)

SMART Domains

Protein: ENSMUSP00000105896
Gene: ENSMUSG00000022340
AA Change: V638A

Domain	Start	End	E-Value	Type
low complexity region	20	35	N/A	INTRINSIC
low complexity region	46	77	N/A	INTRINSIC
low complexity region	136	147	N/A	INTRINSIC
low complexity region	148	162	N/A	INTRINSIC
low complexity region	192	203	N/A	INTRINSIC
Pfam:Syntaphilin	214	511	5.8e-140	PFAM
low complexity region	610	627	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000110269
AA Change: V566A

PolyPhen 2 Score 0.702 (Sensitivity: 0.86; Specificity: 0.92)

SMART Domains

Protein: ENSMUSP00000105898
Gene: ENSMUSG00000022340
AA Change: V566A

Domain	Start	End	E-Value	Type
low complexity region	64	75	N/A	INTRINSIC
low complexity region	76	90	N/A	INTRINSIC
low complexity region	120	131	N/A	INTRINSIC
Pfam:Syntaphilin	142	439	4.4e-140	PFAM
low complexity region	538	555	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000226214

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000226825

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000227081

Predicted Effect

possibly damaging
Transcript: ENSMUST00000227305
AA Change: V637A

PolyPhen 2 Score 0.702 (Sensitivity: 0.86; Specificity: 0.92)

Predicted Effect

possibly damaging
Transcript: ENSMUST00000228057
AA Change: V638A

PolyPhen 2 Score 0.577 (Sensitivity: 0.88; Specificity: 0.91)

Meta Mutation Damage Score

0.1054

Coding Region Coverage

1x: 99.1%
3x: 98.4%
10x: 97.0%
20x: 94.0%

Validation Efficiency

93% (40/43)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Syntabulin/GOLSYN is part of a kinesin motor-adaptor complex that is critical for the anterograde axonal transport of active zone components and contributes to activity-dependent presynaptic assembly during neuronal development (Cai et al., 2007 [PubMed 17611281]).[supplied by OMIM, Mar 2008]

Allele List at MGI

Other mutations in this stock

Total: 41 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Appl1	G	A	14: 26,927,844	T575M	probably damaging	Het
Atp2c1	A	T	9: 105,422,976	M708K	probably damaging	Het
C9	A	G	15: 6,483,119	T241A	possibly damaging	Het
Ccrl2	T	C	9: 111,056,364	D22G	probably benign	Het
Cd47	A	G	16: 49,867,842	I42V	probably benign	Het
Cntnap5c	T	C	17: 58,330,202	S1025P	probably benign	Het
Col8a1	T	C	16: 57,626,916	M744V	unknown	Het
Cstf3	A	G	2: 104,653,086		probably benign	Het
Dnah8	G	A	17: 30,854,898	R4514H	probably damaging	Het
Dnaic1	G	A	4: 41,602,615	R113H	probably damaging	Het
Fry	T	C	5: 150,454,572	S410P	probably damaging	Het
Glt6d1	ACCC	ACCCC	2: 25,795,167		probably null	Het
Gm10717	A	G	9: 3,025,532	Y39C	probably benign	Het
Hivep1	C	T	13: 42,158,601	T1439I	probably benign	Het
Iqgap2	T	C	13: 95,668,528		probably null	Het
Kbtbd11	T	A	8: 15,029,118	C572*	probably null	Het
Kif1c	T	C	11: 70,703,771	F86L	possibly damaging	Het
Kirrel	C	T	3: 87,089,151	M380I	probably null	Het
Ldb1	C	T	19: 46,044,892		probably benign	Het
Lrmda	T	A	14: 22,027,331		probably benign	Het
Med23	T	C	10: 24,891,120	L369S	probably damaging	Het
Mei1	A	G	15: 82,103,204	H399R	possibly damaging	Het
Myo1b	G	T	1: 51,776,346	H614N	possibly damaging	Het
Neurl1b	C	T	17: 26,414,975	T4M	probably damaging	Het
Olfr1095	T	C	2: 86,851,591	T36A	probably benign	Het
Olfr129	T	C	17: 38,055,368	Y66C	probably damaging	Het
Polg	G	A	7: 79,456,791	Q163*	probably null	Het
Pramef8	A	G	4: 143,419,379	T473A	probably benign	Het
Sdk2	G	A	11: 113,800,244	P1835L	probably damaging	Het
Slc35a5	A	T	16: 45,147,322	I138N	probably damaging	Het
Snx31	T	C	15: 36,523,558		probably null	Het
Speg	A	T	1: 75,426,782	H2590L	probably damaging	Het
Spink4	T	A	4: 40,929,136	C54S	probably damaging	Het
Swap70	A	G	7: 110,270,047	E349G	probably damaging	Het
Tns3	G	A	11: 8,492,999	R455W	probably damaging	Het
Tnxb	T	A	17: 34,712,964	V2157E	possibly damaging	Het
Trak2	A	T	1: 58,946,245		probably null	Het
Trav18	C	T	14: 53,831,617	R39C	possibly damaging	Het
Uroc1	G	A	6: 90,346,355	V352M	probably damaging	Het
Zfp106	A	C	2: 120,534,599	I442M	probably benign	Het
Zfp935	G	A	13: 62,455,032	Q98*	probably null	Het

Other mutations in Sybu

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01453:Sybu	APN	15	44672805	missense	probably damaging	1.00
IGL02211:Sybu	APN	15	44673466	missense	probably damaging	1.00
IGL02303:Sybu	APN	15	44673223	missense	probably benign	0.03
E7848:Sybu	UTSW	15	44673422	missense	probably benign	0.32
R0015:Sybu	UTSW	15	44673500	missense	probably damaging	0.99
R0015:Sybu	UTSW	15	44673500	missense	probably damaging	0.99
R0064:Sybu	UTSW	15	44672993	missense	probably benign	0.00
R0064:Sybu	UTSW	15	44672993	missense	probably benign	0.00
R0413:Sybu	UTSW	15	44673272	missense	probably damaging	1.00
R0650:Sybu	UTSW	15	44673268	missense	probably benign	0.08
R1147:Sybu	UTSW	15	44746255	missense	probably damaging	1.00
R1147:Sybu	UTSW	15	44746255	missense	probably damaging	1.00
R1307:Sybu	UTSW	15	44675390	missense	probably damaging	1.00
R1568:Sybu	UTSW	15	44718832	nonsense	probably null
R2112:Sybu	UTSW	15	44673335	missense	probably benign	0.06
R2967:Sybu	UTSW	15	44746356	missense	probably damaging	1.00
R3120:Sybu	UTSW	15	44672959	missense	possibly damaging	0.88
R3429:Sybu	UTSW	15	44746458	missense	probably damaging	0.98
R3508:Sybu	UTSW	15	44673082	missense	probably damaging	1.00
R4080:Sybu	UTSW	15	44718943	missense	probably damaging	1.00
R4898:Sybu	UTSW	15	44675499	missense	probably benign	0.02
R4975:Sybu	UTSW	15	44677667	missense	probably damaging	1.00
R5066:Sybu	UTSW	15	44677644	missense	probably damaging	1.00
R5783:Sybu	UTSW	15	44746414	missense	probably damaging	0.96
R5913:Sybu	UTSW	15	44787621	missense	probably damaging	1.00
R6977:Sybu	UTSW	15	44677695	missense	probably benign	0.00
R7044:Sybu	UTSW	15	44677695	missense	possibly damaging	0.79
R7139:Sybu	UTSW	15	44677714	missense	possibly damaging	0.93
R7328:Sybu	UTSW	15	44787794	missense	not run
R7543:Sybu	UTSW	15	44683452	critical splice acceptor site	probably null
R7851:Sybu	UTSW	15	44746456	nonsense	probably null
R7909:Sybu	UTSW	15	44673037	nonsense	probably null
R7934:Sybu	UTSW	15	44746456	nonsense	probably null
R7990:Sybu	UTSW	15	44673037	nonsense	probably null
Z1177:Sybu	UTSW	15	44673062	missense	probably damaging	0.98

Predicted Primers

PCR Primer
(F):5'- AGGCTTCAACTGACTATAGTGC -3'
(R):5'- AGCTAGATTTTGCAGCCTACAC -3'

Sequencing Primer
(F):5'- GGCTTCAACTGACTATAGTGCAAATC -3'
(R):5'- GCTAGATTTTGCAGCCTACACAGAAG -3'

Posted On

2015-01-23