Incidental Mutation 'R3774:Dhdh'
ID273503
Institutional Source Beutler Lab
Gene Symbol Dhdh
Ensembl Gene ENSMUSG00000011382
Gene Namedihydrodiol dehydrogenase (dimeric)
Synonyms1300018L09Rik, Xld1, Xld-1
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.076) question?
Stock #R3774 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location45470987-45488805 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 45481938 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Valine at position 157 (D157V)
Ref Sequence ENSEMBL: ENSMUSP00000011526 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000011526] [ENSMUST00000107758] [ENSMUST00000107759] [ENSMUST00000210813]
Predicted Effect probably benign
Transcript: ENSMUST00000011526
AA Change: D157V

PolyPhen 2 Score 0.058 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000011526
Gene: ENSMUSG00000011382
AA Change: D157V

DomainStartEndE-ValueType
Pfam:GFO_IDH_MocA 3 124 2e-25 PFAM
low complexity region 307 320 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000107758
SMART Domains Protein: ENSMUSP00000103387
Gene: ENSMUSG00000023467

DomainStartEndE-ValueType
low complexity region 100 108 N/A INTRINSIC
Pfam:Tub 203 451 4.1e-85 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000107759
SMART Domains Protein: ENSMUSP00000103388
Gene: ENSMUSG00000023467

DomainStartEndE-ValueType
low complexity region 100 108 N/A INTRINSIC
Pfam:Tub 203 444 3.4e-117 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000209450
Predicted Effect noncoding transcript
Transcript: ENSMUST00000210440
Predicted Effect unknown
Transcript: ENSMUST00000210701
AA Change: D58V
Predicted Effect probably benign
Transcript: ENSMUST00000210813
Predicted Effect noncoding transcript
Transcript: ENSMUST00000211413
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an enzyme that belongs to the family of dihydrodiol dehydrogenases, which exist in multiple forms in mammalian tissues and are involved in the metabolism of xenobiotics and sugars. These enzymes catalyze the NADP1-linked oxidation of transdihydrodiols of aromatic hydrocarbons to corresponding catechols. This enzyme is a dimeric dihydrodiol dehydrogenase, and it differs from monomeric dihydrodiol dehydrogenases in its high substrate specificity for trans-dihydrodiols of aromatic hydrocarbons in the oxidative direction. [provided by RefSeq, Jul 2008]
PHENOTYPE: This locus controls electrophoretic variation in xylose dehydrogenase. The a allele determines a fast anodally migrating band in IS/Cam; the b allele determines a slower band in most inbreds; the c allele determines no band in 101/H. a/b heterozygotes show 3-bands, suggesting the enzyme is a dimer. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acadm A G 3: 153,933,097 V213A probably benign Het
Ccndbp1 A G 2: 121,009,100 K26R possibly damaging Het
Chrna10 T C 7: 102,114,328 T87A probably benign Het
Col27a1 T A 4: 63,314,726 N360K probably benign Het
Crispld2 T C 8: 120,029,266 S325P probably damaging Het
Dgkd T A 1: 87,936,300 I79N probably damaging Het
Dnajc15 A T 14: 77,856,937 probably null Het
Fbxo44 G T 4: 148,156,594 F179L probably damaging Het
Gm5565 T A 5: 146,158,609 E192V probably benign Het
Gpat4 G A 8: 23,180,155 P286L probably damaging Het
Itgav A G 2: 83,791,964 E630G probably damaging Het
Iws1 T C 18: 32,079,995 S159P probably damaging Het
Kif23 G A 9: 61,924,992 S623L probably benign Het
Krt32 A G 11: 100,088,121 C36R probably benign Het
Med12l A C 3: 59,247,942 Q1181P probably damaging Het
Megf10 G A 18: 57,277,105 G653S probably damaging Het
Mon1a A G 9: 107,901,303 Y242C probably damaging Het
Msh6 G T 17: 87,986,181 R788L probably damaging Het
Mttp T C 3: 138,114,263 probably null Het
Mxi1 C A 19: 53,371,729 A294E probably benign Het
Olfm5 T A 7: 104,161,849 R27S possibly damaging Het
Olfr667 T A 7: 104,916,906 Y130F probably benign Het
Palmd T C 3: 116,927,663 E81G probably damaging Het
Pecr A G 1: 72,259,371 F297L probably benign Het
Phf11b A G 14: 59,326,057 L137S probably benign Het
Phlpp1 GAGCAGCAGCAGCAGCAGCAGCAGCAGCAGC GAGCAGCAGCAGCAGCAGCAGCAGCAGC 1: 106,393,191 probably benign Het
Plcb4 A G 2: 135,958,145 K472E probably benign Het
Pomgnt1 G A 4: 116,154,128 R230H probably damaging Het
Pomt1 A G 2: 32,244,250 H261R possibly damaging Het
Ppm1d T C 11: 85,337,167 I303T probably damaging Het
Ptprc T G 1: 138,064,773 Q1205H probably damaging Het
Rad23b C T 4: 55,382,589 T264I possibly damaging Het
Rfc1 T C 5: 65,264,406 Y1050C probably damaging Het
Sept8 T C 11: 53,537,579 V352A probably damaging Het
Slc25a13 T A 6: 6,109,288 Q358L probably damaging Het
Ssh1 T C 5: 113,966,722 D12G probably damaging Het
Tmem59l A G 8: 70,487,301 L6S unknown Het
Tnik T C 3: 28,638,419 Y820H probably damaging Het
Trpm3 T C 19: 22,978,602 F1143L possibly damaging Het
Trpm3 T A 19: 22,987,975 S1611R probably benign Het
Ttyh3 A G 5: 140,648,734 F32L probably damaging Het
Unkl T A 17: 25,188,407 probably null Het
Vwf T A 6: 125,649,099 probably null Het
Wdr11 T A 7: 129,631,693 probably null Het
Yeats2 A G 16: 20,150,495 D12G probably damaging Het
Other mutations in Dhdh
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02172:Dhdh APN 7 45475617 missense probably damaging 1.00
R0020:Dhdh UTSW 7 45488104 missense probably benign 0.00
R0331:Dhdh UTSW 7 45488120 missense probably benign 0.26
R0514:Dhdh UTSW 7 45488706 missense probably benign 0.16
R0890:Dhdh UTSW 7 45481971 missense possibly damaging 0.80
R4967:Dhdh UTSW 7 45479106 missense probably damaging 1.00
R7000:Dhdh UTSW 7 45475274 missense possibly damaging 0.68
Predicted Primers
Posted On2015-03-25