Mutagenetix > Incidental Mutation

Incidental Mutation 'R3912:Atp2c2'

309462

Institutional Source

Beutler Lab

Gene Symbol

Atp2c2

Ensembl Gene

ENSMUSG00000034112

Gene Name

ATPase, Ca++ transporting, type 2C, member 2

Synonyms

MMRRC Submission

040910-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R3912 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

119700009-119757717 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 119721276 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Lysine to Glutamic Acid at position 103 (K103E)

Ref Sequence

ENSEMBL: ENSMUSP00000148585 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000095171] [ENSMUST00000212454]

AlphaFold

A7L9Z8

Predicted Effect

probably damaging
Transcript: ENSMUST00000095171
AA Change: K103E

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000092794
Gene: ENSMUSG00000034112
AA Change: K103E

Domain	Start	End	E-Value	Type
Cation_ATPase_N	54	128	1.27e-12	SMART
Pfam:E1-E2_ATPase	133	366	1.7e-62	PFAM
Pfam:Hydrolase	371	684	5.3e-18	PFAM
Pfam:HAD	374	681	7.4e-11	PFAM
Pfam:Cation_ATPase	437	521	1.1e-17	PFAM
Pfam:Cation_ATPase_C	754	927	1.1e-47	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000212454
AA Change: K103E

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

Meta Mutation Damage Score

0.3755

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.2%
20x: 94.8%

Validation Efficiency

100% (56/56)

Allele List at MGI

Other mutations in this stock

Total: 53 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2010111I01Rik	G	T	13: 63,156,706	E402*	probably null	Het
9030624J02Rik	A	G	7: 118,746,390	T49A	possibly damaging	Het
Acot1	A	G	12: 84,017,032	S305G	probably damaging	Het
Acot12	A	G	13: 91,770,089	D167G	probably benign	Het
Adgra1	T	C	7: 139,845,714		probably null	Het
Adh7	T	A	3: 138,221,780	V29E	probably damaging	Het
Camkk1	A	G	11: 73,033,816	D285G	probably benign	Het
Ccdc158	G	C	5: 92,648,935	T514S	possibly damaging	Het
Cdhr5	T	A	7: 141,273,857	D210V	probably damaging	Het
Cndp1	C	T	18: 84,631,999	D190N	probably benign	Het
Eepd1	C	T	9: 25,483,304	T288M	probably damaging	Het
Erbin	G	A	13: 103,886,338		probably benign	Het
Erbin	G	T	13: 103,862,287	T197K	probably benign	Het
Fnip2	A	T	3: 79,479,505	D971E	possibly damaging	Het
Gab2	A	G	7: 97,299,073	Y290C	probably damaging	Het
Gbp3	C	T	3: 142,566,338		probably benign	Het
Gm14326	T	C	2: 177,945,865	K446R	probably damaging	Het
Gm5724	A	G	6: 141,727,636	F392S	probably damaging	Het
Herc2	T	C	7: 56,098,437	Y518H	probably damaging	Het
Id2	T	A	12: 25,095,872	K47*	probably null	Het
Ilf2	A	G	3: 90,487,060	N295S	probably benign	Het
Ilf3	C	T	9: 21,398,126	A526V	possibly damaging	Het
Ints10	T	A	8: 68,813,620	S478T	probably damaging	Het
Kirrel	C	T	3: 87,089,151	M380I	probably null	Het
Lrrc7	G	A	3: 158,291,952	L158F	probably damaging	Het
Mroh9	C	T	1: 163,066,069	C179Y	probably damaging	Het
Mrps18b	C	T	17: 35,910,939	V165I	probably benign	Het
Myrip	A	G	9: 120,432,616	S432G	probably benign	Het
Nutm2	C	T	13: 50,472,940	A377V	possibly damaging	Het
Olfr700	A	T	7: 106,805,865	V199D	probably damaging	Het
Pate4	C	A	9: 35,611,844	M1I	probably null	Het
Pax7	C	A	4: 139,780,898	W272L	probably benign	Het
Ppp1r12b	C	T	1: 134,887,318	E320K	probably damaging	Het
Prg4	T	C	1: 150,451,868	Y278C	probably damaging	Het
Pvr	T	C	7: 19,909,292	N339D	probably benign	Het
Rev3l	A	G	10: 39,820,556	I521M	probably damaging	Het
Ryr2	A	G	13: 11,772,427	I1020T	probably damaging	Het
Scn4a	T	A	11: 106,320,716	I1492F	probably damaging	Het
Sec16a	C	T	2: 26,414,387	G2304D	probably damaging	Het
Shisa7	T	A	7: 4,830,240	R341*	probably null	Het
Slc19a3	T	A	1: 83,022,703	M198L	probably benign	Het
Slc26a8	T	A	17: 28,644,779	N669Y	possibly damaging	Het
Snap91	T	C	9: 86,792,557	T534A	possibly damaging	Het
Susd4	A	T	1: 182,887,466	Y284F	probably damaging	Het
Tas1r1	A	T	4: 152,031,924	Y418N	probably damaging	Het
Tdrd12	A	G	7: 35,487,713	I584T	probably damaging	Het
Tmtc3	A	C	10: 100,449,026	N582K	probably damaging	Het
Tnfrsf11b	G	A	15: 54,256,182		probably benign	Het
Trim30a	A	G	7: 104,411,141	V476A	probably damaging	Het
Vmn1r39	C	T	6: 66,805,141	M27I	probably benign	Het
Vmn2r59	T	C	7: 42,046,320	T223A	probably benign	Het
Vwa5a	T	C	9: 38,734,743	I469T	probably damaging	Het
Wnt3a	A	C	11: 59,250,002	D229E	possibly damaging	Het

Other mutations in Atp2c2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00966:Atp2c2	APN	8	119745590	missense	probably benign
IGL01624:Atp2c2	APN	8	119757450	missense	probably benign	0.00
IGL02133:Atp2c2	APN	8	119754335	missense	probably benign	0.00
IGL02221:Atp2c2	APN	8	119744334	missense	probably damaging	1.00
IGL02606:Atp2c2	APN	8	119730274	missense	probably benign
IGL02657:Atp2c2	APN	8	119753032	missense	probably damaging	1.00
IGL02839:Atp2c2	APN	8	119749120	missense	possibly damaging	0.85
IGL03122:Atp2c2	APN	8	119742675	missense	possibly damaging	0.77
R0031:Atp2c2	UTSW	8	119749062	missense	probably benign	0.15
R0372:Atp2c2	UTSW	8	119757441	missense	probably benign
R0502:Atp2c2	UTSW	8	119734577	missense	probably null	0.99
R0503:Atp2c2	UTSW	8	119734577	missense	probably null	0.99
R0584:Atp2c2	UTSW	8	119738418	missense	probably benign	0.01
R1225:Atp2c2	UTSW	8	119735245	missense	probably damaging	1.00
R1580:Atp2c2	UTSW	8	119752987	missense	probably benign	0.00
R1620:Atp2c2	UTSW	8	119749126	missense	probably benign
R1638:Atp2c2	UTSW	8	119756003	missense	possibly damaging	0.82
R1745:Atp2c2	UTSW	8	119725094	missense	probably benign	0.02
R1746:Atp2c2	UTSW	8	119734443	unclassified	probably benign
R1907:Atp2c2	UTSW	8	119749876	splice site	probably benign
R2104:Atp2c2	UTSW	8	119749845	missense	probably benign
R2151:Atp2c2	UTSW	8	119756102	missense	probably benign
R2152:Atp2c2	UTSW	8	119756102	missense	probably benign
R2154:Atp2c2	UTSW	8	119756102	missense	probably benign
R2207:Atp2c2	UTSW	8	119748309	missense	probably damaging	1.00
R3874:Atp2c2	UTSW	8	119735296	missense	possibly damaging	0.74
R4093:Atp2c2	UTSW	8	119749871	critical splice donor site	probably null
R4782:Atp2c2	UTSW	8	119749152	missense	probably damaging	0.97
R4801:Atp2c2	UTSW	8	119747687	missense	probably damaging	1.00
R4973:Atp2c2	UTSW	8	119754263	missense	probably benign	0.00
R5485:Atp2c2	UTSW	8	119753062	critical splice donor site	probably null
R5978:Atp2c2	UTSW	8	119749875	splice site	probably null
R6377:Atp2c2	UTSW	8	119726354	missense	probably benign	0.10
R6613:Atp2c2	UTSW	8	119756021	missense	probably damaging	0.99
R6765:Atp2c2	UTSW	8	119753017	missense	probably damaging	1.00
R6836:Atp2c2	UTSW	8	119734415	missense	probably damaging	1.00
R6963:Atp2c2	UTSW	8	119730267	nonsense	probably null
R7220:Atp2c2	UTSW	8	119745561	missense	probably benign	0.00
R7238:Atp2c2	UTSW	8	119742421	missense	possibly damaging	0.73
R7373:Atp2c2	UTSW	8	119730252	missense	probably benign	0.02
R7438:Atp2c2	UTSW	8	119748197	missense	probably damaging	1.00
R7573:Atp2c2	UTSW	8	119751269	missense	probably damaging	1.00
R7677:Atp2c2	UTSW	8	119748176	missense	probably benign	0.00
R7737:Atp2c2	UTSW	8	119742395	missense	probably damaging	1.00
R7912:Atp2c2	UTSW	8	119730178	missense	possibly damaging	0.81
R8821:Atp2c2	UTSW	8	119749294	splice site	probably null
R8831:Atp2c2	UTSW	8	119749294	splice site	probably null
R9200:Atp2c2	UTSW	8	119748260	nonsense	probably null
R9211:Atp2c2	UTSW	8	119719293	missense	probably benign
R9246:Atp2c2	UTSW	8	119730250	missense	probably damaging	1.00
R9285:Atp2c2	UTSW	8	119738402	missense	probably benign	0.00
RF004:Atp2c2	UTSW	8	119752822	missense	probably damaging	1.00
RF012:Atp2c2	UTSW	8	119745514	missense	possibly damaging	0.91
Z1177:Atp2c2	UTSW	8	119734385	missense	probably benign	0.00

Predicted Primers

PCR Primer
(F):5'- TCTTCTCCTGCAGGGACAAG -3'
(R):5'- CATCCAGGAGCACAGAACTG -3'

Sequencing Primer
(F):5'- AGAAGATGCCGGCTCTCAC -3'
(R):5'- TCCAGGAGCACAGAACTGTTTATC -3'

Posted On

2015-04-17