Incidental Mutation 'R3977:Slco1a5'
ID311072
Institutional Source Beutler Lab
Gene Symbol Slco1a5
Ensembl Gene ENSMUSG00000063975
Gene Namesolute carrier organic anion transporter family, member 1a5
SynonymsOatp3, Slc21a7
MMRRC Submission 040940-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.067) question?
Stock #R3977 (G1)
Quality Score225
Status Validated
Chromosome6
Chromosomal Location142234227-142322981 bp(-) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) A to G at 142258972 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000124829 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000081380] [ENSMUST00000111825] [ENSMUST00000128446] [ENSMUST00000153268]
Predicted Effect probably benign
Transcript: ENSMUST00000081380
SMART Domains Protein: ENSMUSP00000080116
Gene: ENSMUSG00000063975

DomainStartEndE-ValueType
Pfam:MFS_1 22 420 4.3e-30 PFAM
KAZAL 438 486 2.18e0 SMART
transmembrane domain 600 622 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000111822
Predicted Effect probably benign
Transcript: ENSMUST00000111825
SMART Domains Protein: ENSMUSP00000137607
Gene: ENSMUSG00000063975

DomainStartEndE-ValueType
Pfam:MFS_1 22 420 5.8e-30 PFAM
KAZAL 438 486 2.18e0 SMART
transmembrane domain 600 622 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000128446
SMART Domains Protein: ENSMUSP00000124987
Gene: ENSMUSG00000063975

DomainStartEndE-ValueType
Pfam:OATP 1 157 6.1e-67 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000153268
SMART Domains Protein: ENSMUSP00000124829
Gene: ENSMUSG00000063975

DomainStartEndE-ValueType
Pfam:OATP 19 74 3.4e-16 PFAM
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 93.7%
Validation Efficiency 96% (50/52)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a sodium-independent transporter which mediates cellular uptake of organic ions in the liver. Its substrates include bile acids, bromosulphophthalein, and some steroidal compounds. The protein is a member of the SLC21A family of solute carriers. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, Dec 2008]
PHENOTYPE: Homozygous mutation of this gene results in decreased percentage of CD8 ells and increased percentage of B cells in the peripheral blood. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ace C T 11: 105,981,838 P942L possibly damaging Het
Adam28 A G 14: 68,610,994 V671A probably benign Het
Arfgef1 A G 1: 10,209,634 V236A probably benign Het
B020004C17Rik G T 14: 57,017,188 M156I possibly damaging Het
Bicral T A 17: 46,830,991 M1L unknown Het
Brpf3 A G 17: 28,807,042 E363G possibly damaging Het
Ccdc96 T C 5: 36,485,166 L172P possibly damaging Het
Cln3 G A 7: 126,580,136 probably benign Het
Dnah7c T C 1: 46,628,911 I1526T possibly damaging Het
Fmo3 T G 1: 162,958,578 E281A probably damaging Het
Frem2 A G 3: 53,652,070 I1672T probably benign Het
Gbp2b A G 3: 142,603,709 I194V probably benign Het
Gprc6a C A 10: 51,621,101 V449L probably benign Het
Hk1 A G 10: 62,290,319 V396A probably benign Het
Hoxc13 T C 15: 102,921,240 V18A possibly damaging Het
Hr A G 14: 70,563,584 T699A probably benign Het
Il19 A T 1: 130,936,033 C74S probably damaging Het
Krt2 T C 15: 101,811,127 T703A unknown Het
Lrig2 A T 3: 104,457,844 V664E probably damaging Het
Lrrc37a T C 11: 103,457,604 K2755R unknown Het
Man1c1 G C 4: 134,703,438 P11R probably damaging Het
Mbtd1 A G 11: 93,905,175 N13D probably benign Het
Mfsd4b5 T C 10: 39,974,708 probably benign Het
Nras A G 3: 103,060,225 I46V probably benign Het
Oasl1 C T 5: 114,932,898 T274I probably damaging Het
Ogfod2 C A 5: 124,113,209 probably null Het
Olfr1264 C A 2: 90,021,745 G107V probably damaging Het
Olfr1369-ps1 T A 13: 21,115,861 H56Q probably benign Het
Olfr1419 C A 19: 11,870,505 R237L possibly damaging Het
Olfr1420 T A 19: 11,896,516 F165Y probably damaging Het
Olfr774 C T 10: 129,238,508 R120C probably damaging Het
Olfr96 T C 17: 37,225,158 V11A probably benign Het
Pkmyt1 A G 17: 23,735,331 M362V probably benign Het
Ppfia2 A G 10: 106,830,629 T399A possibly damaging Het
Ppp1r12b A G 1: 134,765,975 S983P probably benign Het
Ptpn22 A G 3: 103,873,641 probably benign Het
Raph1 A T 1: 60,498,523 D491E probably benign Het
Rc3h1 A G 1: 160,959,399 probably null Het
Rtn4 T C 11: 29,693,819 L5P probably benign Het
Sdccag3 T A 2: 26,384,793 N364I probably damaging Het
Slc23a4 C T 6: 34,953,788 V400I probably benign Het
Smpd1 T C 7: 105,555,901 F329S probably benign Het
Sycp2l A G 13: 41,141,964 I334M probably damaging Het
Tas2r103 A G 6: 133,036,317 L262P probably benign Het
Ten1 G A 11: 116,216,945 probably null Het
Tfap2d C G 1: 19,104,494 S57C possibly damaging Het
Tnr A G 1: 159,892,023 M957V probably benign Het
Trbv13-3 A G 6: 41,130,145 probably benign Het
Trp53rkb C T 2: 166,795,526 A134V possibly damaging Het
Trp63 A G 16: 25,820,740 probably benign Het
Vmn2r112 T A 17: 22,603,115 V258E probably damaging Het
Vmn2r74 T C 7: 85,958,137 Y126C probably benign Het
Vmn2r96 T A 17: 18,597,679 I698N probably damaging Het
Other mutations in Slco1a5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01304:Slco1a5 APN 6 142242150 missense probably benign 0.00
IGL01432:Slco1a5 APN 6 142236286 missense possibly damaging 0.59
IGL01590:Slco1a5 APN 6 142250319 missense probably benign 0.01
IGL01824:Slco1a5 APN 6 142253037 missense probably benign 0.01
IGL01915:Slco1a5 APN 6 142243873 missense probably benign 0.00
IGL01945:Slco1a5 APN 6 142243989 critical splice acceptor site probably null
IGL02078:Slco1a5 APN 6 142254446 missense probably benign 0.30
IGL02178:Slco1a5 APN 6 142262688 nonsense probably null
IGL02366:Slco1a5 APN 6 142250215 missense possibly damaging 0.57
IGL02395:Slco1a5 APN 6 142275487 missense probably damaging 0.99
IGL02621:Slco1a5 APN 6 142242015 missense probably benign 0.10
IGL02752:Slco1a5 APN 6 142262712 missense probably benign 0.07
IGL02940:Slco1a5 APN 6 142242005 missense probably damaging 1.00
IGL03065:Slco1a5 APN 6 142248843 splice site probably benign
IGL03377:Slco1a5 APN 6 142234766 missense probably benign 0.01
R0017:Slco1a5 UTSW 6 142236335 splice site probably benign
R0017:Slco1a5 UTSW 6 142236335 splice site probably benign
R0230:Slco1a5 UTSW 6 142236328 splice site probably benign
R0690:Slco1a5 UTSW 6 142268278 missense probably benign 0.24
R1217:Slco1a5 UTSW 6 142254374 missense probably damaging 0.98
R1900:Slco1a5 UTSW 6 142242063 missense probably benign 0.44
R2084:Slco1a5 UTSW 6 142234711 missense probably benign 0.32
R2393:Slco1a5 UTSW 6 142248775 missense possibly damaging 0.85
R2414:Slco1a5 UTSW 6 142236250 missense probably damaging 1.00
R2760:Slco1a5 UTSW 6 142250271 missense probably benign 0.00
R3420:Slco1a5 UTSW 6 142268238 missense possibly damaging 0.61
R3421:Slco1a5 UTSW 6 142268238 missense possibly damaging 0.61
R3827:Slco1a5 UTSW 6 142253249 missense probably damaging 0.97
R3963:Slco1a5 UTSW 6 142248644 critical splice donor site probably null
R4074:Slco1a5 UTSW 6 142268224 missense possibly damaging 0.88
R4075:Slco1a5 UTSW 6 142268224 missense possibly damaging 0.88
R4076:Slco1a5 UTSW 6 142268224 missense possibly damaging 0.88
R4782:Slco1a5 UTSW 6 142248807 missense possibly damaging 0.82
R4799:Slco1a5 UTSW 6 142248807 missense possibly damaging 0.82
R4831:Slco1a5 UTSW 6 142234705 missense probably benign
R5038:Slco1a5 UTSW 6 142262637 missense probably benign 0.01
R5038:Slco1a5 UTSW 6 142266364 missense probably damaging 1.00
R5063:Slco1a5 UTSW 6 142259065 missense probably damaging 1.00
R5273:Slco1a5 UTSW 6 142242098 missense probably benign 0.00
R5436:Slco1a5 UTSW 6 142254392 missense probably damaging 1.00
R5579:Slco1a5 UTSW 6 142242125 missense possibly damaging 0.93
R5602:Slco1a5 UTSW 6 142275529 start gained probably benign
R5643:Slco1a5 UTSW 6 142237594 splice site probably null
R5644:Slco1a5 UTSW 6 142237594 splice site probably null
R5686:Slco1a5 UTSW 6 142236307 missense probably damaging 1.00
R5699:Slco1a5 UTSW 6 142248816 missense probably damaging 0.96
R5792:Slco1a5 UTSW 6 142242113 missense probably damaging 1.00
R5938:Slco1a5 UTSW 6 142248717 missense probably damaging 0.97
R5997:Slco1a5 UTSW 6 142253113 missense probably benign 0.19
R6146:Slco1a5 UTSW 6 142234808 missense probably benign
R6377:Slco1a5 UTSW 6 142242180 splice site probably null
R6466:Slco1a5 UTSW 6 142237534 missense probably benign 0.01
R6523:Slco1a5 UTSW 6 142266395 missense probably damaging 1.00
R7092:Slco1a5 UTSW 6 142248675 missense probably benign
R7207:Slco1a5 UTSW 6 142248749 nonsense probably null
R7356:Slco1a5 UTSW 6 142234732 missense probably benign 0.01
R7430:Slco1a5 UTSW 6 142248712 missense probably benign 0.00
R7445:Slco1a5 UTSW 6 142259008 missense possibly damaging 0.93
R7499:Slco1a5 UTSW 6 142262531 intron probably null
R7579:Slco1a5 UTSW 6 142275481 missense probably benign 0.00
R8117:Slco1a5 UTSW 6 142262692 missense probably damaging 1.00
R8209:Slco1a5 UTSW 6 142262682 missense probably damaging 1.00
R8217:Slco1a5 UTSW 6 142275476 missense probably benign 0.13
Predicted Primers PCR Primer
(F):5'- ACCATGTCTGGAGCTACTGG -3'
(R):5'- CATGGCCTGTAACCAGAGAAATAG -3'

Sequencing Primer
(F):5'- CATGTCTGGAGCTACTGGTCAAC -3'
(R):5'- CCTGTAACCAGAGAAATAGTTGCAG -3'
Posted On2015-04-29