Incidental Mutation 'R3961:Mme'
ID 312076
Institutional Source Beutler Lab
Gene Symbol Mme
Ensembl Gene ENSMUSG00000027820
Gene Name membrane metallo endopeptidase
Synonyms neprilysin, 6030454K05Rik, neutral endopeptidase, NEP, CD10
MMRRC Submission 040836-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R3961 (G1)
Quality Score 225
Status Not validated
Chromosome 3
Chromosomal Location 63202632-63291134 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 63252613 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Methionine to Lysine at position 419 (M419K)
Ref Sequence ENSEMBL: ENSMUSP00000141544 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029400] [ENSMUST00000194134] [ENSMUST00000194150]
AlphaFold Q61391
Predicted Effect probably damaging
Transcript: ENSMUST00000029400
AA Change: M419K

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000029400
Gene: ENSMUSG00000027820
AA Change: M419K

DomainStartEndE-ValueType
PDB:2YVC|F 2 23 5e-7 PDB
transmembrane domain 29 51 N/A INTRINSIC
Pfam:Peptidase_M13_N 80 483 8.7e-103 PFAM
low complexity region 489 507 N/A INTRINSIC
low complexity region 515 526 N/A INTRINSIC
Pfam:Peptidase_M13 543 749 5.8e-75 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000193805
Predicted Effect probably damaging
Transcript: ENSMUST00000194134
AA Change: M419K

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000142205
Gene: ENSMUSG00000027820
AA Change: M419K

DomainStartEndE-ValueType
PDB:2YVC|F 2 23 5e-7 PDB
transmembrane domain 29 51 N/A INTRINSIC
Pfam:Peptidase_M13_N 80 483 8.4e-134 PFAM
low complexity region 489 507 N/A INTRINSIC
low complexity region 515 526 N/A INTRINSIC
Pfam:Peptidase_M13 543 749 3.3e-67 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000194150
AA Change: M419K

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000141544
Gene: ENSMUSG00000027820
AA Change: M419K

DomainStartEndE-ValueType
PDB:2YVC|F 2 23 5e-7 PDB
transmembrane domain 29 51 N/A INTRINSIC
Pfam:Peptidase_M13_N 80 483 8.4e-134 PFAM
low complexity region 489 507 N/A INTRINSIC
low complexity region 515 526 N/A INTRINSIC
Pfam:Peptidase_M13 543 749 3.3e-67 PFAM
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 93.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a common acute lymphocytic leukemia antigen that is an important cell surface marker in the diagnosis of human acute lymphocytic leukemia (ALL). This protein is present on leukemic cells of pre-B phenotype, which represent 85% of cases of ALL. This protein is not restricted to leukemic cells, however, and is found on a variety of normal tissues. It is a glycoprotein that is particularly abundant in kidney, where it is present on the brush border of proximal tubules and on glomerular epithelium. The protein is a neutral endopeptidase that cleaves peptides at the amino side of hydrophobic residues and inactivates several peptide hormones including glucagon, enkephalins, substance P, neurotensin, oxytocin, and bradykinin. This gene, which encodes a 100-kD type II transmembrane glycoprotein, exists in a single copy of greater than 45 kb. The 5' untranslated region of this gene is alternatively spliced, resulting in four separate mRNA transcripts. The coding region is not affected by alternative splicing. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit enhanced allergic contact dermatitis responses, diffuse hepatic necrosis after LPS shock or treatment with a combination of TNF and interleukin-1 beta, and increased brain and plasma amyloid beta peptide levels. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 28 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9930111J21Rik1 T C 11: 48,838,803 (GRCm39) T595A possibly damaging Het
Bicral T C 17: 47,135,751 (GRCm39) I486M probably damaging Het
Btbd1 C A 7: 81,468,083 (GRCm39) E146* probably null Het
Cdcp1 T C 9: 123,011,446 (GRCm39) T344A possibly damaging Het
Cenpm A T 15: 82,118,574 (GRCm39) L180Q possibly damaging Het
Cers3 G T 7: 66,435,823 (GRCm39) A261S probably benign Het
Dazl A G 17: 50,595,161 (GRCm39) V91A probably damaging Het
Dsc2 C T 18: 20,184,284 (GRCm39) V35I probably damaging Het
Fras1 T C 5: 96,825,244 (GRCm39) probably null Het
Ltbp3 G A 19: 5,804,050 (GRCm39) R854Q probably benign Het
Minar1 G A 9: 89,483,963 (GRCm39) T478I probably damaging Het
Ncan G A 8: 70,562,950 (GRCm39) T436M probably benign Het
Nphp3 G T 9: 103,880,241 (GRCm39) E88* probably null Het
Or5ak23 T C 2: 85,245,216 (GRCm39) I2M possibly damaging Het
Pdcl T C 2: 37,242,199 (GRCm39) M184V probably benign Het
Polr3b T C 10: 84,520,166 (GRCm39) M694T possibly damaging Het
Pramel12 T A 4: 143,145,888 (GRCm39) N452K probably benign Het
Prkdc T G 16: 15,647,475 (GRCm39) probably null Het
Prss35 A G 9: 86,637,802 (GRCm39) M191V probably benign Het
Rtn3 T C 19: 7,435,510 (GRCm39) S142G probably damaging Het
Slc19a3 A T 1: 83,000,678 (GRCm39) F113Y probably damaging Het
Taf7 A G 18: 37,776,174 (GRCm39) V131A probably benign Het
Tesk1 A G 4: 43,445,133 (GRCm39) probably null Het
Tmem131 C T 1: 36,858,031 (GRCm39) D741N probably damaging Het
Tmem63a G A 1: 180,790,679 (GRCm39) D446N possibly damaging Het
Tpte A G 8: 22,849,431 (GRCm39) S553G probably damaging Het
Trpv3 A T 11: 73,178,246 (GRCm39) K438* probably null Het
Vmn2r107 G A 17: 20,595,717 (GRCm39) G757R probably damaging Het
Other mutations in Mme
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00235:Mme APN 3 63,247,465 (GRCm39) missense possibly damaging 0.95
IGL00329:Mme APN 3 63,287,749 (GRCm39) nonsense probably null
IGL01013:Mme APN 3 63,235,281 (GRCm39) splice site probably null
IGL01316:Mme APN 3 63,247,580 (GRCm39) splice site probably benign
IGL01333:Mme APN 3 63,253,512 (GRCm39) missense probably damaging 1.00
IGL01392:Mme APN 3 63,269,467 (GRCm39) missense probably damaging 1.00
IGL01566:Mme APN 3 63,269,350 (GRCm39) splice site probably benign
IGL01739:Mme APN 3 63,247,534 (GRCm39) missense possibly damaging 0.78
IGL01996:Mme APN 3 63,250,970 (GRCm39) missense probably benign 0.11
IGL02125:Mme APN 3 63,256,070 (GRCm39) missense probably damaging 1.00
IGL02154:Mme APN 3 63,250,976 (GRCm39) missense probably benign
IGL03214:Mme APN 3 63,237,111 (GRCm39) missense possibly damaging 0.72
IGL03291:Mme APN 3 63,253,525 (GRCm39) missense probably benign 0.00
R0498:Mme UTSW 3 63,253,487 (GRCm39) missense probably damaging 1.00
R0595:Mme UTSW 3 63,235,602 (GRCm39) missense probably benign 0.27
R0980:Mme UTSW 3 63,247,550 (GRCm39) missense probably benign
R1210:Mme UTSW 3 63,251,027 (GRCm39) missense probably benign 0.01
R1600:Mme UTSW 3 63,272,479 (GRCm39) missense probably damaging 1.00
R1852:Mme UTSW 3 63,235,467 (GRCm39) missense probably benign 0.00
R1852:Mme UTSW 3 63,235,404 (GRCm39) missense probably benign 0.31
R2037:Mme UTSW 3 63,235,681 (GRCm39) missense probably null 1.00
R2177:Mme UTSW 3 63,208,426 (GRCm39) missense probably benign 0.02
R2200:Mme UTSW 3 63,287,713 (GRCm39) missense possibly damaging 0.87
R2306:Mme UTSW 3 63,207,673 (GRCm39) missense probably benign 0.00
R2847:Mme UTSW 3 63,252,620 (GRCm39) missense possibly damaging 0.91
R3008:Mme UTSW 3 63,266,378 (GRCm39) missense probably damaging 1.00
R3749:Mme UTSW 3 63,250,961 (GRCm39) missense probably damaging 1.00
R3876:Mme UTSW 3 63,269,480 (GRCm39) splice site probably benign
R3981:Mme UTSW 3 63,235,485 (GRCm39) missense probably damaging 1.00
R3982:Mme UTSW 3 63,235,485 (GRCm39) missense probably damaging 1.00
R3983:Mme UTSW 3 63,235,485 (GRCm39) missense probably damaging 1.00
R4494:Mme UTSW 3 63,254,613 (GRCm39) missense probably benign
R4589:Mme UTSW 3 63,287,693 (GRCm39) missense probably benign
R4706:Mme UTSW 3 63,256,133 (GRCm39) missense possibly damaging 0.92
R4871:Mme UTSW 3 63,247,453 (GRCm39) missense probably benign 0.01
R4957:Mme UTSW 3 63,250,910 (GRCm39) splice site probably benign
R5053:Mme UTSW 3 63,272,270 (GRCm39) missense probably damaging 1.00
R5316:Mme UTSW 3 63,276,375 (GRCm39) missense probably damaging 1.00
R5502:Mme UTSW 3 63,207,702 (GRCm39) nonsense probably null
R5579:Mme UTSW 3 63,256,066 (GRCm39) missense probably damaging 1.00
R6007:Mme UTSW 3 63,250,929 (GRCm39) nonsense probably null
R6022:Mme UTSW 3 63,272,218 (GRCm39) missense probably damaging 1.00
R6143:Mme UTSW 3 63,207,532 (GRCm39) splice site probably null
R6154:Mme UTSW 3 63,207,674 (GRCm39) missense probably damaging 0.98
R6333:Mme UTSW 3 63,249,382 (GRCm39) missense probably benign 0.00
R6476:Mme UTSW 3 63,251,056 (GRCm39) critical splice donor site probably null
R6514:Mme UTSW 3 63,272,265 (GRCm39) nonsense probably null
R6711:Mme UTSW 3 63,249,339 (GRCm39) missense possibly damaging 0.93
R6842:Mme UTSW 3 63,269,465 (GRCm39) missense probably damaging 1.00
R6996:Mme UTSW 3 63,253,523 (GRCm39) missense possibly damaging 0.63
R7040:Mme UTSW 3 63,276,344 (GRCm39) missense probably damaging 1.00
R7043:Mme UTSW 3 63,252,638 (GRCm39) nonsense probably null
R7084:Mme UTSW 3 63,235,638 (GRCm39) missense probably damaging 0.98
R7126:Mme UTSW 3 63,276,322 (GRCm39) missense probably damaging 0.97
R7783:Mme UTSW 3 63,272,288 (GRCm39) missense probably damaging 1.00
R8501:Mme UTSW 3 63,234,156 (GRCm39) missense probably damaging 1.00
R8857:Mme UTSW 3 63,256,070 (GRCm39) missense probably damaging 1.00
R9453:Mme UTSW 3 63,272,306 (GRCm39) missense possibly damaging 0.90
R9556:Mme UTSW 3 63,272,225 (GRCm39) missense probably damaging 0.97
R9648:Mme UTSW 3 63,208,426 (GRCm39) missense probably benign 0.02
X0058:Mme UTSW 3 63,272,442 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGCAGGATCTTCAGCCAGAC -3'
(R):5'- CCAAGGTGAAATCTGTTGAGAAC -3'

Sequencing Primer
(F):5'- TCTTCAGCCAGACATAAAGACTAGTG -3'
(R):5'- GTGAAATCTGTTGAGAACAATGGTAC -3'
Posted On 2015-04-29