Incidental Mutation 'R4127:Ubash3a'
ID315455
Institutional Source Beutler Lab
Gene Symbol Ubash3a
Ensembl Gene ENSMUSG00000042345
Gene Nameubiquitin associated and SH3 domain containing, A
Synonyms5830413C03Rik, Sts-2, TULA
MMRRC Submission 040860-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4127 (G1)
Quality Score225
Status Not validated
Chromosome17
Chromosomal Location31207873-31242202 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 31237275 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Histidine at position 506 (Y506H)
Ref Sequence ENSEMBL: ENSMUSP00000045890 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000048656]
PDB Structure
Crystal structure of the 2H-phosphatase domain of Sts-2 [X-RAY DIFFRACTION]
Crystal structure of the 2H-phosphatase domain of Sts-2 in complex with tungstate. [X-RAY DIFFRACTION]
Crystal structure of the 2H-phosphatase domain of Sts-2 in complex with phosphate [X-RAY DIFFRACTION]
Predicted Effect probably damaging
Transcript: ENSMUST00000048656
AA Change: Y506H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000045890
Gene: ENSMUSG00000042345
AA Change: Y506H

DomainStartEndE-ValueType
Pfam:UBA 23 57 2.6e-7 PFAM
SH3 241 302 5.53e-10 SMART
Pfam:His_Phos_1 402 601 6.5e-21 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151620
Meta Mutation Damage Score 0.5822 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes one of two family members belonging to the T-cell ubiquitin ligand (TULA) family. Both family members can negatively regulate T-cell signaling. This family member can facilitate growth factor withdrawal-induced apoptosis in T cells, which may occur via its interaction with AIF, an apoptosis-inducing factor. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, Aug 2011]
PHENOTYPE: Homozygous null mice are viable and healthy with no abnormalities detected in any of the hematopoietic lineages. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca13 A G 11: 9,191,973 H3R probably benign Het
Actg2 A T 6: 83,522,884 F128Y possibly damaging Het
Ankrd6 G A 4: 32,822,241 T176M probably damaging Het
Atp6ap1l T C 13: 90,898,707 D117G probably damaging Het
Cd209b A G 8: 3,918,714 I284T probably damaging Het
Cfl2 C T 12: 54,861,358 A123T probably benign Het
Cgnl1 T C 9: 71,724,540 T510A probably benign Het
Chn2 G T 6: 54,272,978 R24M probably damaging Het
Cyfip2 T C 11: 46,270,647 I339V probably benign Het
Etl4 C T 2: 20,744,075 P539L possibly damaging Het
Fras1 A G 5: 96,770,653 D3516G probably benign Het
Frem2 T C 3: 53,525,896 Y2669C probably damaging Het
Gga2 G T 7: 122,002,720 H205N probably damaging Het
Gm5592 G A 7: 41,289,067 G591D probably benign Het
Gtf3c1 A T 7: 125,647,450 C1562* probably null Het
Heatr3 T A 8: 88,138,311 C59S probably damaging Het
Heatr5b A G 17: 78,753,174 M2024T possibly damaging Het
Jarid2 T C 13: 44,902,256 S313P probably damaging Het
Lzts3 A G 2: 130,635,365 S502P probably damaging Het
Olfr1163 A G 2: 88,071,235 V49A probably benign Het
Pcdhb2 A T 18: 37,295,541 D189V probably damaging Het
Pias3 G T 3: 96,699,666 G82C probably damaging Het
Polg T C 7: 79,455,537 E753G probably damaging Het
Pus10 T C 11: 23,718,654 probably null Het
Pxn A G 5: 115,546,907 R264G probably damaging Het
Rag1 A G 2: 101,642,071 Y909H probably damaging Het
Rell2 A G 18: 37,958,214 H144R probably benign Het
Rufy4 T C 1: 74,147,663 C537R probably damaging Het
Ryr2 C T 13: 11,587,437 V4520I possibly damaging Het
Scp2 A G 4: 108,063,984 F10L probably benign Het
Slc9b2 T C 3: 135,329,837 Y356H probably benign Het
Sorcs1 T C 19: 50,222,159 D756G probably benign Het
Stra6 T A 9: 58,151,218 V454E probably damaging Het
Tbc1d8 T C 1: 39,372,431 N1108S probably benign Het
Tep1 C T 14: 50,843,734 R1349Q possibly damaging Het
Tmem132d T C 5: 128,268,820 R213G probably benign Het
Xcr1 A C 9: 123,856,496 V67G probably damaging Het
Zranb2 C A 3: 157,537,590 C74* probably null Het
Other mutations in Ubash3a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00921:Ubash3a APN 17 31228186 missense probably benign
IGL01310:Ubash3a APN 17 31215142 missense probably benign 0.03
IGL01450:Ubash3a APN 17 31208231 missense probably damaging 1.00
IGL02429:Ubash3a APN 17 31241305 missense probably benign 0.00
IGL02458:Ubash3a APN 17 31231481 missense possibly damaging 0.94
IGL03014:Ubash3a UTSW 17 31239224 missense probably damaging 1.00
R1033:Ubash3a UTSW 17 31208212 missense probably damaging 1.00
R1700:Ubash3a UTSW 17 31215044 missense probably damaging 0.99
R2212:Ubash3a UTSW 17 31218034 missense probably damaging 1.00
R3800:Ubash3a UTSW 17 31231470 missense probably benign 0.24
R4125:Ubash3a UTSW 17 31237275 missense probably damaging 1.00
R4128:Ubash3a UTSW 17 31237275 missense probably damaging 1.00
R4224:Ubash3a UTSW 17 31237928 missense probably damaging 1.00
R4786:Ubash3a UTSW 17 31217964 missense probably benign 0.31
R5311:Ubash3a UTSW 17 31219717 missense probably damaging 0.99
R5782:Ubash3a UTSW 17 31235503 missense probably benign 0.05
R5804:Ubash3a UTSW 17 31208232 critical splice donor site probably null
R6244:Ubash3a UTSW 17 31239272 missense possibly damaging 0.90
R6263:Ubash3a UTSW 17 31215095 missense probably benign 0.22
R6574:Ubash3a UTSW 17 31232396 missense probably damaging 1.00
R6736:Ubash3a UTSW 17 31231415 missense probably benign
R7041:Ubash3a UTSW 17 31228210 missense probably benign 0.00
R7458:Ubash3a UTSW 17 31208165 missense probably benign 0.02
R7490:Ubash3a UTSW 17 31232312 missense probably damaging 1.00
R7991:Ubash3a UTSW 17 31237895 missense probably benign 0.34
Predicted Primers PCR Primer
(F):5'- CTCTAGGTTTGTTGTATCCAAATGC -3'
(R):5'- GTCAGCTTTATCAGGAATACCCC -3'

Sequencing Primer
(F):5'- CAAATGCTTGTTTCCATTGACCCAAG -3'
(R):5'- CATCTTCCATGCGTGGTCAGG -3'
Posted On2015-05-14