Mutagenetix > Incidental Mutations

Incidental Mutation 'R4246:Asxl3'

320440

Institutional Source

Beutler Lab

Gene Symbol

Asxl3

Ensembl Gene

ENSMUSG00000045215

Gene Name

additional sex combs like 3, transcriptional regulator

Synonyms

D930044O18Rik, LOC381127, C230079D11Rik, D430002O22Rik

MMRRC Submission

041062-MU

Accession Numbers

Is this an essential gene?

Possibly non essential (E-score: 0.499) question?

Stock #

R4246 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

22344883-22530227 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 22525500 bp

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Glycine at position 2189 (D2189G)

Ref Sequence

ENSEMBL: ENSMUSP00000112793 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000097655] [ENSMUST00000120223]

Predicted Effect

probably damaging
Transcript: ENSMUST00000097655
AA Change: D2189G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000095260
Gene: ENSMUSG00000045215
AA Change: D2189G

Domain	Start	End	E-Value	Type
low complexity region	98	112	N/A	INTRINSIC
Pfam:ASXH	173	305	5.6e-50	PFAM
low complexity region	391	404	N/A	INTRINSIC
low complexity region	667	686	N/A	INTRINSIC
low complexity region	939	954	N/A	INTRINSIC
low complexity region	978	988	N/A	INTRINSIC
low complexity region	1002	1023	N/A	INTRINSIC
low complexity region	1160	1168	N/A	INTRINSIC
low complexity region	1424	1436	N/A	INTRINSIC
low complexity region	1681	1691	N/A	INTRINSIC
SCOP:d1dnpa2	1946	1995	6e-3	SMART
low complexity region	2035	2050	N/A	INTRINSIC
Pfam:PHD_3	2139	2202	9.8e-28	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000120223
AA Change: D2189G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000112793
Gene: ENSMUSG00000045215
AA Change: D2189G

Domain	Start	End	E-Value	Type
low complexity region	98	112	N/A	INTRINSIC
Pfam:ASXH	179	304	1.3e-36	PFAM
low complexity region	391	404	N/A	INTRINSIC
low complexity region	667	686	N/A	INTRINSIC
low complexity region	939	954	N/A	INTRINSIC
low complexity region	978	988	N/A	INTRINSIC
low complexity region	1002	1023	N/A	INTRINSIC
low complexity region	1160	1168	N/A	INTRINSIC
low complexity region	1424	1436	N/A	INTRINSIC
low complexity region	1681	1691	N/A	INTRINSIC
SCOP:d1dnpa2	1946	1995	6e-3	SMART
low complexity region	2035	2050	N/A	INTRINSIC
Pfam:PHD_3	2138	2202	1.9e-24	PFAM

Coding Region Coverage

1x: 99.3%
3x: 98.7%
10x: 97.5%
20x: 95.9%

Validation Efficiency

Allele List at MGI

Other mutations in this stock

Total: 42 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2700062C07Rik	A	G	18: 24,472,956	N36S	possibly damaging	Het
Ak1	A	G	2: 32,633,372	T151A	possibly damaging	Het
Ccdc91	C	T	6: 147,592,148	A346V	unknown	Het
Dnah6	C	T	6: 73,129,448	E1769K	probably benign	Het
Dock6	A	T	9: 21,839,490		probably null	Het
Fhod3	A	G	18: 24,990,066	K271R	probably null	Het
Glyatl3	T	A	17: 40,910,098	D126V	probably benign	Het
Gm15922	C	T	7: 3,737,349	G291E	probably damaging	Het
Gnal	C	G	18: 67,088,583	P19R	unknown	Het
Igkv8-21	T	A	6: 70,315,452	M1L	possibly damaging	Het
Itih4	C	A	14: 30,891,402	H261N	probably damaging	Het
Jpt1	T	C	11: 115,514,293		probably benign	Het
Kif14	G	T	1: 136,473,388	M492I	possibly damaging	Het
Klhl32	A	C	4: 24,800,822	S3A	possibly damaging	Het
Kmt2d	C	T	15: 98,840,089		probably benign	Het
Lamtor5	T	C	3: 107,279,038	V41A	probably benign	Het
Lmtk3	G	A	7: 45,794,062	C723Y	possibly damaging	Het
Lrfn1	G	T	7: 28,459,942	V429L	probably benign	Het
Mapkbp1	T	A	2: 120,013,027	I252N	probably damaging	Het
Nelfa	A	G	5: 33,899,029	F464S	probably damaging	Het
Nipbl	G	A	15: 8,332,432	L1454F	probably damaging	Het
Nr4a3	C	T	4: 48,083,125	P553S	possibly damaging	Het
Nrg3	G	A	14: 39,472,241	T187I	possibly damaging	Het
Olfr1030	T	A	2: 85,984,280	C147S	possibly damaging	Het
Olfr957	A	G	9: 39,511,603	V39A	probably benign	Het
Pcdha8	A	G	18: 36,992,897	E144G	probably damaging	Het
Pik3cb	T	C	9: 99,101,176		probably null	Het
Pkd1l1	C	T	11: 8,865,543	R1456K	possibly damaging	Het
Ppp1r3a	T	A	6: 14,719,781	E378V	probably damaging	Het
Psd2	T	C	18: 36,006,119	L540P	probably damaging	Het
Rnf14	T	A	18: 38,301,648		probably null	Het
Satl1	A	G	X: 112,406,336	S141P	probably benign	Het
Setx	GTGGCT	GT	2: 29,154,061		probably null	Het
Sh3d19	G	A	3: 86,126,688	V783I	probably benign	Het
Snca	T	C	6: 60,733,165	E110G	possibly damaging	Het
Sumf1	A	C	6: 108,155,013	V156G	probably damaging	Het
Trhr	A	T	15: 44,233,460		probably null	Het
Tsen2	A	G	6: 115,547,824		probably benign	Het
Tuft1	C	A	3: 94,614,801	M319I	probably benign	Het
Vill	C	A	9: 119,060,393	N132K	probably damaging	Het
Wars2	T	A	3: 99,216,588	V255E	probably damaging	Het
Zcchc14	CTGATGGTGGTGGTGATGGTGGTGG	CTGATGGTGGTGG	8: 121,604,292		probably benign	Het

Other mutations in Asxl3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00429:Asxl3	APN	18	22525223	missense	probably benign	0.41
IGL00510:Asxl3	APN	18	22523565	missense	probably damaging	1.00
IGL00864:Asxl3	APN	18	22522446	missense	probably benign	0.06
IGL01074:Asxl3	APN	18	22522845	missense	probably damaging	1.00
IGL01305:Asxl3	APN	18	22516446	missense	probably benign	0.06
IGL01313:Asxl3	APN	18	22517459	missense	probably benign	0.41
IGL01349:Asxl3	APN	18	22524237	missense	probably benign	0.28
IGL01529:Asxl3	APN	18	22517655	missense	probably damaging	1.00
IGL01574:Asxl3	APN	18	22523564	missense	probably benign	0.06
IGL01583:Asxl3	APN	18	22516597	missense	probably benign	0.01
IGL01619:Asxl3	APN	18	22523328	missense	probably damaging	1.00
IGL01720:Asxl3	APN	18	22525325	missense	probably damaging	1.00
IGL01816:Asxl3	APN	18	22522488	missense	probably benign	0.10
IGL01828:Asxl3	APN	18	22525558	utr 3 prime	probably benign
IGL01903:Asxl3	APN	18	22434576	missense	probably benign	0.00
IGL01906:Asxl3	APN	18	22522281	missense	probably benign	0.01
IGL01962:Asxl3	APN	18	22522445	missense	probably benign	0.00
IGL01991:Asxl3	APN	18	22516162	missense	probably damaging	1.00
IGL02064:Asxl3	APN	18	22524344	missense	possibly damaging	0.59
IGL02187:Asxl3	APN	18	22524978	missense	probably damaging	0.99
IGL02219:Asxl3	APN	18	22453626	missense	possibly damaging	0.81
IGL02309:Asxl3	APN	18	22522453	missense	probably benign	0.01
IGL02478:Asxl3	APN	18	22523013	missense	possibly damaging	0.77
IGL02506:Asxl3	APN	18	22452399	missense	probably benign	0.19
IGL02660:Asxl3	APN	18	22524345	missense	probably damaging	0.98
IGL02828:Asxl3	APN	18	22524661	missense	possibly damaging	0.87
IGL02863:Asxl3	APN	18	22523484	missense	probably benign	0.01
IGL03001:Asxl3	APN	18	22517398	missense	probably damaging	1.00
IGL03143:Asxl3	APN	18	22522974	missense	probably benign	0.43
ANU22:Asxl3	UTSW	18	22516446	missense	probably benign	0.06
BB001:Asxl3	UTSW	18	22525545	missense	probably damaging	0.98
BB011:Asxl3	UTSW	18	22525545	missense	probably damaging	0.98
R0145:Asxl3	UTSW	18	22453605	missense	probably damaging	1.00
R0201:Asxl3	UTSW	18	22523154	missense	probably benign
R0207:Asxl3	UTSW	18	22411496	splice site	probably benign
R0230:Asxl3	UTSW	18	22452326	splice site	probably benign
R0242:Asxl3	UTSW	18	22516681	missense	possibly damaging	0.94
R0242:Asxl3	UTSW	18	22516681	missense	possibly damaging	0.94
R0344:Asxl3	UTSW	18	22517611	missense	probably benign	0.00
R0519:Asxl3	UTSW	18	22523520	missense	possibly damaging	0.85
R0520:Asxl3	UTSW	18	22522986	missense	probably damaging	0.96
R0548:Asxl3	UTSW	18	22521792	splice site	probably benign
R0626:Asxl3	UTSW	18	22522880	missense	probably benign	0.02
R0711:Asxl3	UTSW	18	22524451	missense	probably benign	0.01
R0744:Asxl3	UTSW	18	22516040	missense	probably damaging	1.00
R0833:Asxl3	UTSW	18	22516040	missense	probably damaging	1.00
R1035:Asxl3	UTSW	18	22525049	missense	probably damaging	1.00
R1170:Asxl3	UTSW	18	22524507	missense	probably benign	0.00
R1372:Asxl3	UTSW	18	22410009	missense	probably benign	0.00
R1440:Asxl3	UTSW	18	22525224	missense	probably benign	0.13
R1463:Asxl3	UTSW	18	22516753	missense	possibly damaging	0.94
R1471:Asxl3	UTSW	18	22516354	missense	probably damaging	1.00
R1618:Asxl3	UTSW	18	22516987	missense	probably damaging	1.00
R1720:Asxl3	UTSW	18	22452435	missense	probably damaging	1.00
R1819:Asxl3	UTSW	18	22522376	missense	probably damaging	1.00
R1824:Asxl3	UTSW	18	22522068	missense	probably damaging	1.00
R1851:Asxl3	UTSW	18	22517739	missense	probably damaging	0.97
R1989:Asxl3	UTSW	18	22452363	missense	probably damaging	1.00
R2041:Asxl3	UTSW	18	22523451	missense	probably benign	0.02
R2174:Asxl3	UTSW	18	22453644	missense	possibly damaging	0.76
R2175:Asxl3	UTSW	18	22516595	missense	probably benign
R2443:Asxl3	UTSW	18	22411539	missense	probably benign	0.12
R2907:Asxl3	UTSW	18	22517273	missense	possibly damaging	0.56
R4254:Asxl3	UTSW	18	22524366	missense	possibly damaging	0.58
R4441:Asxl3	UTSW	18	22524233	missense	probably damaging	0.97
R4660:Asxl3	UTSW	18	22516477	missense	probably benign	0.00
R4661:Asxl3	UTSW	18	22516477	missense	probably benign	0.00
R4674:Asxl3	UTSW	18	22517738	missense	probably damaging	1.00
R4749:Asxl3	UTSW	18	22516769	missense	probably damaging	0.99
R4817:Asxl3	UTSW	18	22525454	missense	probably damaging	0.97
R4935:Asxl3	UTSW	18	22523312	missense	probably benign	0.06
R5062:Asxl3	UTSW	18	22522718	missense	possibly damaging	0.92
R5064:Asxl3	UTSW	18	22516019	missense	probably benign	0.00
R5065:Asxl3	UTSW	18	22525299	missense	possibly damaging	0.94
R5066:Asxl3	UTSW	18	22525299	missense	possibly damaging	0.94
R5067:Asxl3	UTSW	18	22525299	missense	possibly damaging	0.94
R5133:Asxl3	UTSW	18	22516708	missense	probably damaging	1.00
R5174:Asxl3	UTSW	18	22523115	missense	probably benign	0.45
R5183:Asxl3	UTSW	18	22525299	missense	possibly damaging	0.94
R5294:Asxl3	UTSW	18	22516439	missense	possibly damaging	0.77
R5416:Asxl3	UTSW	18	22524494	missense	probably damaging	1.00
R5587:Asxl3	UTSW	18	22525247	missense	probably benign	0.28
R5873:Asxl3	UTSW	18	22516085	missense	probably benign	0.04
R6240:Asxl3	UTSW	18	22465508	missense	probably damaging	1.00
R6242:Asxl3	UTSW	18	22522376	missense	probably damaging	1.00
R6316:Asxl3	UTSW	18	22522782	missense	probably damaging	1.00
R6348:Asxl3	UTSW	18	22517273	missense	possibly damaging	0.56
R6518:Asxl3	UTSW	18	22516340	missense	probably damaging	0.96
R6605:Asxl3	UTSW	18	22517077	nonsense	probably null
R6704:Asxl3	UTSW	18	22517305	missense	probably benign	0.00
R6706:Asxl3	UTSW	18	22453609	missense	probably damaging	1.00
R6786:Asxl3	UTSW	18	22525440	missense	probably damaging	1.00
R6799:Asxl3	UTSW	18	22465400	nonsense	probably null
R6811:Asxl3	UTSW	18	22522911	missense	possibly damaging	0.87
R6817:Asxl3	UTSW	18	22523580	missense	probably benign	0.00
R6830:Asxl3	UTSW	18	22525388	missense	probably benign	0.45
R6957:Asxl3	UTSW	18	22522091	missense	probably damaging	1.00
R7015:Asxl3	UTSW	18	22523921	missense	probably benign	0.00
R7058:Asxl3	UTSW	18	22517674	missense	probably damaging	1.00
R7135:Asxl3	UTSW	18	22517701	nonsense	probably null
R7135:Asxl3	UTSW	18	22517702	missense	probably damaging	1.00
R7231:Asxl3	UTSW	18	22411499	critical splice acceptor site	probably null
R7231:Asxl3	UTSW	18	22517540	missense	probably damaging	1.00
R7431:Asxl3	UTSW	18	22516953	missense	probably damaging	1.00
R7851:Asxl3	UTSW	18	22517222	missense	possibly damaging	0.62
R7871:Asxl3	UTSW	18	22524224	missense	not run
R7880:Asxl3	UTSW	18	22522151	missense	possibly damaging	0.90
R7924:Asxl3	UTSW	18	22525545	missense	probably damaging	0.98
R8061:Asxl3	UTSW	18	22524243	missense	possibly damaging	0.62
R8115:Asxl3	UTSW	18	22517585	missense	probably damaging	0.99
R8174:Asxl3	UTSW	18	22517743	missense	probably benign	0.02
R8303:Asxl3	UTSW	18	22524416	missense	probably benign
R8360:Asxl3	UTSW	18	22516117	missense	probably benign
R8547:Asxl3	UTSW	18	22522772	missense	probably benign	0.04
Z1088:Asxl3	UTSW	18	22516772	missense	probably benign	0.00
Z1176:Asxl3	UTSW	18	22522220	missense	probably damaging	1.00
Z1177:Asxl3	UTSW	18	22516339	missense	probably benign	0.00
Z1177:Asxl3	UTSW	18	22523591	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- ATTCTGGGAAGTGGCTCCAAC -3'
(R):5'- ATCAACCCCTGTATGAGAAACG -3'

Sequencing Primer
(F):5'- AAGTGGCTCCAACCCCGC -3'
(R):5'- ACCTAGAAAAACCCAAGATGATTTAC -3'

Posted On

2015-06-12