Mutagenetix > Incidental Mutations

Incidental Mutation 'R0001:Tgm5'

32221

Institutional Source

Beutler Lab

Gene Symbol

Tgm5

Ensembl Gene

ENSMUSG00000053675

Gene Name

transglutaminase 5

Synonyms

2310007C07Rik, TGx

MMRRC Submission

038297-MU

Accession Numbers

Is this an essential gene?

Possibly non essential (E-score: 0.324) question?

Stock #

R0001 (G1)

Quality Score

204

Status

Validated

Chromosome

Chromosomal Location

121046111-121085841 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to T at 121077646 bp

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Glutamic Acid at position 16 (D16E)

Ref Sequence

ENSEMBL: ENSMUSP00000028721 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000028721]

Predicted Effect

probably damaging
Transcript: ENSMUST00000028721
AA Change: D16E

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000028721
Gene: ENSMUSG00000053675
AA Change: D16E

Domain	Start	End	E-Value	Type
Pfam:Transglut_N	11	127	1.4e-31	PFAM
TGc	275	368	1.86e-49	SMART
Pfam:Transglut_C	511	610	2.5e-23	PFAM
Pfam:Transglut_C	624	722	1.8e-27	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000142674

Meta Mutation Damage Score

0.2674

Coding Region Coverage

1x: 99.2%
3x: 98.5%
10x: 96.9%
20x: 94.6%

Validation Efficiency

99% (76/77)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the transglutaminase family. The encoded protein catalyzes formation of protein cross-links between glutamine and lysine residues, often resulting in stabilization of protein assemblies. This reaction is calcium dependent. Mutations in this gene have been associated with acral peeling skin syndrome. [provided by RefSeq, Oct 2009]
PHENOTYPE: Mice homozygous for a null allele display normal skin barrier function and no signs of skin peeling. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 77 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700019N19Rik	G	A	19: 58,789,171	A61V	probably damaging	Het
2900092C05Rik	T	A	7: 12,554,607		probably benign	Het
A4galt	A	G	15: 83,228,289	F98L	probably benign	Het
Abca4	T	G	3: 122,081,011		probably benign	Het
Acacb	C	T	5: 114,204,833		probably benign	Het
Agbl1	A	T	7: 76,419,863	H367L	probably damaging	Het
Apoa4	C	A	9: 46,242,892	Q264K	probably benign	Het
Camsap2	A	T	1: 136,282,888		probably benign	Het
Cdan1	C	A	2: 120,723,751	R939L	probably benign	Het
Ceacam18	G	A	7: 43,636,876	V58I	possibly damaging	Het
Ciita	A	T	16: 10,514,433		probably benign	Het
Clk4	T	A	11: 51,268,765		probably benign	Het
Cntnap2	T	C	6: 46,530,171	D215G	probably benign	Het
Col11a2	T	C	17: 34,061,612	S1218P	probably benign	Het
Col20a1	T	C	2: 180,984,412		probably benign	Het
Ctsb	A	G	14: 63,135,622	E76G	probably benign	Het
Ctu2	T	C	8: 122,478,920	C161R	probably benign	Het
Dhx29	T	C	13: 112,964,556	L1211P	probably damaging	Het
Dhx9	G	T	1: 153,462,636	T759K	probably damaging	Het
Dmxl1	T	C	18: 49,888,897		probably benign	Het
Dpysl3	C	T	18: 43,358,375	E226K	possibly damaging	Het
Eif2d	A	T	1: 131,168,127	K453*	probably null	Het
Epha7	T	C	4: 28,961,279		probably benign	Het
Fam160b1	T	A	19: 57,381,756	H477Q	probably benign	Het
Fat3	T	C	9: 16,377,873	D118G	probably damaging	Het
Foxn4	T	A	5: 114,260,870	Q159L	probably damaging	Het
Frs2	G	T	10: 117,074,876	H194N	possibly damaging	Het
Fut8	A	T	12: 77,475,315	*576L	probably null	Het
Galns	T	C	8: 122,595,883		probably benign	Het
Gamt	G	A	10: 80,259,061		probably benign	Het
Gpn1	T	A	5: 31,495,617		probably benign	Het
Ipcef1	G	T	10: 6,900,600	H330Q	probably damaging	Het
Itga4	A	C	2: 79,326,587	Y1024S	probably damaging	Het
Jak2	A	G	19: 29,282,387	I229V	probably benign	Het
Katnal1	A	G	5: 148,921,275	S42P	probably damaging	Het
Kcnu1	A	T	8: 25,859,270	D142V	probably damaging	Het
Lig3	C	T	11: 82,790,591	R470W	probably damaging	Het
Mgat4c	A	G	10: 102,388,956	S344G	probably benign	Het
Miox	C	T	15: 89,336,274	L189F	possibly damaging	Het
Mipol1	C	T	12: 57,460,839		probably benign	Het
Mki67	C	T	7: 135,699,172	V1378M	probably damaging	Het
Mki67	T	A	7: 135,701,019	D762V	probably damaging	Het
Mmp9	A	G	2: 164,948,383	T43A	probably benign	Het
Muc6	T	C	7: 141,641,574	T1316A	possibly damaging	Het
Naip5	A	G	13: 100,214,650		probably null	Het
Naip5	C	A	13: 100,223,114	S538I	probably benign	Het
Nek3	A	T	8: 22,158,612		probably benign	Het
Nlrp1b	A	G	11: 71,161,759	S948P	probably damaging	Het
Nyap2	A	T	1: 81,192,107	H193L	probably benign	Het
Olfr1413	A	G	1: 92,573,461	K97E	possibly damaging	Het
Olfr648	T	A	7: 104,179,473	K312*	probably null	Het
Patl2	G	A	2: 122,125,710		probably benign	Het
Pcdhb11	A	T	18: 37,423,989	R791W	probably benign	Het
Pkd1l3	C	A	8: 109,628,633		probably benign	Het
Pkn2	A	T	3: 142,828,988	V73D	probably benign	Het
Pknox1	A	T	17: 31,599,636	H281L	probably damaging	Het
Polr3a	A	G	14: 24,452,189		probably benign	Het
Prss38	A	G	11: 59,373,180		probably benign	Het
Rad54l2	A	G	9: 106,708,217	F783S	probably damaging	Het
Rbm5	T	C	9: 107,742,424	R125G	probably damaging	Het
Rnpep	A	G	1: 135,272,485		probably benign	Het
Slc1a5	T	A	7: 16,793,637		probably null	Het
Slc22a4	G	A	11: 54,028,003		probably benign	Het
Spink12	T	C	18: 44,107,696	C50R	probably damaging	Het
Svep1	G	A	4: 58,066,460	T3208I	possibly damaging	Het
Tpp2	A	G	1: 43,971,726	N558D	probably benign	Het
Trappc9	A	T	15: 72,963,662	L507Q	probably damaging	Het
Trpm3	A	T	19: 22,715,331	Q262L	possibly damaging	Het
Ttn	A	G	2: 76,776,972		probably benign	Het
Ttn	G	A	2: 76,832,089		probably benign	Het
Ubr4	T	A	4: 139,451,788	L3316Q	probably damaging	Het
Uckl1	T	A	2: 181,574,655	Y136F	probably damaging	Het
Vmn1r28	G	A	6: 58,265,717	A182T	probably benign	Het
Vps39	A	G	2: 120,318,053	V870A	probably benign	Het
Zdhhc25	A	G	15: 88,600,909	D149G	probably benign	Het
Zfp648	C	T	1: 154,205,286	T397M	probably damaging	Het
Zic2	C	A	14: 122,478,957	T435K	probably damaging	Het

Other mutations in Tgm5

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01061:Tgm5	APN	2	121071496	missense	probably benign	0.01
IGL01148:Tgm5	APN	2	121046675	splice site	probably null
IGL01284:Tgm5	APN	2	121052547	missense	possibly damaging	0.94
IGL01370:Tgm5	APN	2	121053537	missense	probably benign	0.03
IGL01545:Tgm5	APN	2	121052808	missense	probably damaging	1.00
IGL01547:Tgm5	APN	2	121049202	splice site	probably benign
IGL01998:Tgm5	APN	2	121052439	missense	probably damaging	1.00
IGL02577:Tgm5	APN	2	121077603	missense	probably benign	0.01
IGL02636:Tgm5	APN	2	121076796	missense	probably damaging	0.99
PIT4283001:Tgm5	UTSW	2	121071585	missense	possibly damaging	0.48
R0013:Tgm5	UTSW	2	121076882	missense	probably damaging	1.00
R0105:Tgm5	UTSW	2	121077012	missense	probably damaging	1.00
R0105:Tgm5	UTSW	2	121077012	missense	probably damaging	1.00
R0117:Tgm5	UTSW	2	121075102	critical splice donor site	probably null
R0145:Tgm5	UTSW	2	121077581	missense	possibly damaging	0.93
R0356:Tgm5	UTSW	2	121053574	missense	probably damaging	1.00
R0410:Tgm5	UTSW	2	121077558	missense	possibly damaging	0.46
R0519:Tgm5	UTSW	2	121048895	missense	probably damaging	1.00
R1674:Tgm5	UTSW	2	121071544	missense	possibly damaging	0.60
R1773:Tgm5	UTSW	2	121077650	missense	possibly damaging	0.67
R1864:Tgm5	UTSW	2	121075218	missense	probably damaging	1.00
R2276:Tgm5	UTSW	2	121048823	splice site	probably benign
R2511:Tgm5	UTSW	2	121076948	missense	possibly damaging	0.62
R4180:Tgm5	UTSW	2	121076961	missense	probably benign	0.13
R4230:Tgm5	UTSW	2	121070735	missense	probably damaging	1.00
R4801:Tgm5	UTSW	2	121052472	missense	probably damaging	1.00
R4802:Tgm5	UTSW	2	121052472	missense	probably damaging	1.00
R5840:Tgm5	UTSW	2	121085660	critical splice donor site	probably null
R6033:Tgm5	UTSW	2	121070729	splice site	probably null
R6033:Tgm5	UTSW	2	121070729	splice site	probably null
R7064:Tgm5	UTSW	2	121053514	missense	probably benign	0.04
R7102:Tgm5	UTSW	2	121046498	missense	possibly damaging	0.89
R7114:Tgm5	UTSW	2	121048496	nonsense	probably null
R7178:Tgm5	UTSW	2	121085768	start gained	probably benign
R7748:Tgm5	UTSW	2	121052808	missense	probably damaging	1.00
RF022:Tgm5	UTSW	2	121071611	missense	probably damaging	1.00
V3553:Tgm5	UTSW	2	121071502	missense	probably damaging	1.00
X0065:Tgm5	UTSW	2	121070839	missense	probably damaging	1.00
Z1177:Tgm5	UTSW	2	121052451	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- CACACATATCTTGTGGGCCAGTTCC -3'
(R):5'- CTGTATCTGAAGGCTGGGCTGAAG -3'

Sequencing Primer
(F):5'- TGGGCCAGTTCCTTACCAG -3'
(R):5'- agaggaggaagaaagaaaggaag -3'

Posted On

2013-05-09