Incidental Mutation 'R0013:Grm4'
ID32669
Institutional Source Beutler Lab
Gene Symbol Grm4
Ensembl Gene ENSMUSG00000063239
Gene Nameglutamate receptor, metabotropic 4
SynonymsmGluR4, Gprc1d
MMRRC Submission 038308-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0013 (G1)
Quality Score119
Status Validated
Chromosome17
Chromosomal Location27422387-27521403 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 27431575 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Histidine at position 816 (Y816H)
Ref Sequence ENSEMBL: ENSMUSP00000156001 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000118161] [ENSMUST00000118489] [ENSMUST00000231290] [ENSMUST00000231416] [ENSMUST00000231809] [ENSMUST00000232243]
Predicted Effect probably benign
Transcript: ENSMUST00000118161
AA Change: Y816H

PolyPhen 2 Score 0.009 (Sensitivity: 0.96; Specificity: 0.77)
SMART Domains Protein: ENSMUSP00000113819
Gene: ENSMUSG00000063239
AA Change: Y816H

DomainStartEndE-ValueType
signal peptide 1 32 N/A INTRINSIC
Pfam:ANF_receptor 77 482 1.4e-110 PFAM
Pfam:Peripla_BP_6 144 486 9e-13 PFAM
Pfam:NCD3G 516 566 2.4e-14 PFAM
Pfam:7tm_3 599 844 7.6e-58 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000118489
SMART Domains Protein: ENSMUSP00000112578
Gene: ENSMUSG00000063239

DomainStartEndE-ValueType
signal peptide 1 32 N/A INTRINSIC
Pfam:ANF_receptor 77 482 6.2e-104 PFAM
Pfam:Peripla_BP_6 144 486 8.3e-12 PFAM
Pfam:NCD3G 516 566 5.4e-15 PFAM
Pfam:7tm_3 597 817 1.9e-76 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000231290
AA Change: Y816H

PolyPhen 2 Score 0.009 (Sensitivity: 0.96; Specificity: 0.77)
Predicted Effect probably benign
Transcript: ENSMUST00000231416
AA Change: Y561H

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
Predicted Effect probably benign
Transcript: ENSMUST00000231809
AA Change: Y769H

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
Predicted Effect probably benign
Transcript: ENSMUST00000232243
Meta Mutation Damage Score 0.0792 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.8%
Validation Efficiency 94% (79/84)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] L-glutamate is the major excitatory neurotransmitter in the central nervous system and activates both ionotropic and metabotropic glutamate receptors. Glutamatergic neurotransmission is involved in most aspects of normal brain function and can be perturbed in many neuropathologic conditions. The metabotropic glutamate receptors are a family of G protein-coupled receptors, that have been divided into 3 groups on the basis of sequence homology, putative signal transduction mechanisms, and pharmacologic properties. Group I includes GRM1 and GRM5 and these receptors have been shown to activate phospholipase C. Group II includes GRM2 and GRM3 while Group III includes GRM4, GRM6, GRM7 and GRM8. Group II and III receptors are linked to the inhibition of the cyclic AMP cascade but differ in their agonist selectivities. Several transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Feb 2012]
PHENOTYPE: Homozygous mutation of theis gene results in impaired motor learning, and reduced paired-pulse facilitation and post-tetanic potential. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 79 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610028H24Rik A G 10: 76,457,512 M156V probably benign Het
Adnp2 A T 18: 80,129,745 V483D probably damaging Het
Aff1 G T 5: 103,828,484 E491* probably null Het
Agl A T 3: 116,776,608 C911* probably null Het
Akt2 A G 7: 27,636,058 D284G probably damaging Het
Alox15 A G 11: 70,349,635 M240T possibly damaging Het
Antxr2 A G 5: 97,979,985 V229A probably damaging Het
Arap2 G A 5: 62,683,484 L680F probably damaging Het
Btaf1 A G 19: 36,958,373 T188A probably benign Het
Btnl6 G A 17: 34,515,531 Q86* probably null Het
C2cd3 T A 7: 100,416,062 L685H probably damaging Het
Cdh23 T C 10: 60,413,173 T878A possibly damaging Het
Clec4b2 T C 6: 123,202,149 Y137H probably damaging Het
Dchs1 T A 7: 105,755,836 T2500S possibly damaging Het
Def6 A G 17: 28,217,092 Y75C probably damaging Het
Dhx33 A T 11: 70,993,635 F448L probably damaging Het
Dner C T 1: 84,494,893 probably benign Het
Dnmbp G A 19: 43,902,231 P366S probably benign Het
Eif4g3 T C 4: 138,175,848 C1160R possibly damaging Het
Elmod1 G A 9: 53,912,901 probably benign Het
Faah C A 4: 116,004,391 L305F probably damaging Het
Fam71b A G 11: 46,406,804 T312A unknown Het
Flt1 A G 5: 147,571,014 probably benign Het
Fyco1 A T 9: 123,822,406 N1196K probably benign Het
Galnt18 T C 7: 111,554,457 N320S probably damaging Het
Glp2r C A 11: 67,709,712 G437V possibly damaging Het
Gm4884 T C 7: 41,044,292 S562P probably damaging Het
Gm9936 A G 5: 114,857,347 probably benign Het
Gpn2 C A 4: 133,584,792 P112T probably damaging Het
Helz2 A T 2: 181,240,959 S14T probably benign Het
Htt T C 5: 34,820,104 L778P probably benign Het
Il11ra1 T C 4: 41,765,060 S129P probably damaging Het
Ints11 T C 4: 155,887,168 F315S probably damaging Het
Itga11 A T 9: 62,776,613 N1059Y possibly damaging Het
Jak3 A G 8: 71,684,327 S716G probably damaging Het
Kcns1 G T 2: 164,168,643 D65E probably benign Het
Kdm5d A T Y: 941,715 K1305N probably benign Het
Kif26a G T 12: 112,177,880 V1523L probably benign Het
Mboat7 A G 7: 3,683,822 S340P probably damaging Het
Mctp2 T C 7: 72,229,408 I234V probably benign Het
Mex3c G A 18: 73,590,551 A572T probably benign Het
Mpp3 C A 11: 102,005,425 R424L probably benign Het
Mroh4 T A 15: 74,608,237 probably benign Het
Myo9a A T 9: 59,860,206 probably benign Het
Myog T A 1: 134,290,235 H60Q probably damaging Het
Nlrp9a T A 7: 26,571,225 probably null Het
Notch1 A G 2: 26,473,818 V868A possibly damaging Het
Olfr352 A G 2: 36,870,160 N198S probably damaging Het
Olfr59 T A 11: 74,289,051 I135N possibly damaging Het
Olfr73 T C 2: 88,034,266 Y291C possibly damaging Het
Olfr980 A T 9: 40,006,355 I198N probably damaging Het
Pink1 T C 4: 138,317,401 T342A probably benign Het
Plb1 T A 5: 32,349,615 probably benign Het
Plec T C 15: 76,178,246 D2524G probably damaging Het
Plekhg4 G T 8: 105,375,396 E6* probably null Het
Polq T C 16: 37,061,839 F1455S possibly damaging Het
Ppm1e A G 11: 87,249,058 probably benign Het
Prkaca G A 8: 83,988,303 M119I possibly damaging Het
Prss46 G T 9: 110,850,055 S108I probably damaging Het
Ptma C T 1: 86,529,776 probably benign Het
Rab11fip4 C T 11: 79,689,653 T437M probably benign Het
Rngtt T A 4: 33,379,409 M437K probably benign Het
Rrn3 T A 16: 13,813,113 D604E possibly damaging Het
Scn4a A G 11: 106,348,405 probably benign Het
Sis A G 3: 72,910,476 L1468P possibly damaging Het
Slit3 A G 11: 35,707,918 M1450V probably benign Het
Smg5 T C 3: 88,349,233 S269P probably benign Het
Sntg1 T C 1: 8,463,462 T323A probably damaging Het
Son C T 16: 91,651,662 T37I probably damaging Het
Stk17b T C 1: 53,764,132 I41M probably benign Het
Tgm5 T A 2: 121,076,882 Y120F probably damaging Het
Tppp A G 13: 74,021,360 K73R possibly damaging Het
Ttn C A 2: 76,739,158 K27130N probably damaging Het
Ttn C T 2: 76,907,752 V4148I probably benign Het
Uba7 A T 9: 107,978,249 Y375F probably damaging Het
Ugcg T C 4: 59,213,931 L171P possibly damaging Het
Vsig2 T C 9: 37,542,576 probably benign Het
Zcchc11 T A 4: 108,530,955 probably benign Het
Zfp839 T A 12: 110,868,386 S692T possibly damaging Het
Other mutations in Grm4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01154:Grm4 APN 17 27434737 nonsense probably null
IGL02380:Grm4 APN 17 27434661 missense probably damaging 1.00
IGL03244:Grm4 APN 17 27434823 missense probably damaging 0.99
R0352:Grm4 UTSW 17 27451891 splice site probably benign
R0599:Grm4 UTSW 17 27431490 missense probably benign 0.39
R0616:Grm4 UTSW 17 27434564 missense probably damaging 1.00
R0645:Grm4 UTSW 17 27435209 missense probably damaging 1.00
R0726:Grm4 UTSW 17 27438438 splice site probably benign
R1085:Grm4 UTSW 17 27473033 missense probably damaging 1.00
R1486:Grm4 UTSW 17 27434717 missense probably damaging 1.00
R1535:Grm4 UTSW 17 27434801 missense probably benign 0.01
R1799:Grm4 UTSW 17 27472940 missense probably damaging 0.99
R1914:Grm4 UTSW 17 27434712 missense probably damaging 0.99
R2472:Grm4 UTSW 17 27434675 missense probably damaging 1.00
R3759:Grm4 UTSW 17 27435299 missense probably benign 0.00
R4244:Grm4 UTSW 17 27502735 missense probably damaging 1.00
R5390:Grm4 UTSW 17 27434738 missense probably damaging 1.00
R5476:Grm4 UTSW 17 27434798 missense probably benign 0.04
R5516:Grm4 UTSW 17 27438411 missense probably benign 0.06
R5897:Grm4 UTSW 17 27435163 missense probably benign 0.02
R5956:Grm4 UTSW 17 27435155 missense probably benign 0.01
R6391:Grm4 UTSW 17 27435320 missense probably benign 0.00
R7330:Grm4 UTSW 17 27434824 nonsense probably null
R7449:Grm4 UTSW 17 27435371 missense probably damaging 1.00
R8338:Grm4 UTSW 17 27435003 missense probably damaging 1.00
Z1177:Grm4 UTSW 17 27450194 nonsense probably null
Z1177:Grm4 UTSW 17 27450221 missense probably benign 0.12
Predicted Primers PCR Primer
(F):5'- GCCCTTCTGTGTGAACTTGTTGGAC -3'
(R):5'- ACACCTGACACTGTTGACTCTGCC -3'

Sequencing Primer
(F):5'- AACTTGTTGGACATGGTGGC -3'
(R):5'- ataaggacacaggcacgag -3'
Posted On2013-05-09