Mutagenetix > Incidental Mutation

Incidental Mutation 'R0013:Grm4'

32669

Institutional Source

Beutler Lab

Gene Symbol

Grm4

Ensembl Gene

ENSMUSG00000063239

Gene Name

glutamate receptor, metabotropic 4

Synonyms

mGluR4, Gprc1d

MMRRC Submission

038308-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R0013 (G1)

Quality Score

119

Status

Validated

Chromosome

Chromosomal Location

27422387-27521403 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 27431575 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Tyrosine to Histidine at position 816 (Y816H)

Ref Sequence

ENSEMBL: ENSMUSP00000156001 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000118161] [ENSMUST00000118489] [ENSMUST00000231290] [ENSMUST00000231416] [ENSMUST00000231809] [ENSMUST00000232243]

AlphaFold

no structure available at present

Predicted Effect

probably benign
Transcript: ENSMUST00000118161
AA Change: Y816H

PolyPhen 2 Score 0.009 (Sensitivity: 0.96; Specificity: 0.77)

SMART Domains

Protein: ENSMUSP00000113819
Gene: ENSMUSG00000063239
AA Change: Y816H

Domain	Start	End	E-Value	Type
signal peptide	1	32	N/A	INTRINSIC
Pfam:ANF_receptor	77	482	1.4e-110	PFAM
Pfam:Peripla_BP_6	144	486	9e-13	PFAM
Pfam:NCD3G	516	566	2.4e-14	PFAM
Pfam:7tm_3	599	844	7.6e-58	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000118489

SMART Domains

Protein: ENSMUSP00000112578
Gene: ENSMUSG00000063239

Domain	Start	End	E-Value	Type
signal peptide	1	32	N/A	INTRINSIC
Pfam:ANF_receptor	77	482	6.2e-104	PFAM
Pfam:Peripla_BP_6	144	486	8.3e-12	PFAM
Pfam:NCD3G	516	566	5.4e-15	PFAM
Pfam:7tm_3	597	817	1.9e-76	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000231290
AA Change: Y816H

PolyPhen 2 Score 0.009 (Sensitivity: 0.96; Specificity: 0.77)

Predicted Effect

probably benign
Transcript: ENSMUST00000231416
AA Change: Y561H

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)

Predicted Effect

probably benign
Transcript: ENSMUST00000231809
AA Change: Y769H

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)

Predicted Effect

probably benign
Transcript: ENSMUST00000232243

Meta Mutation Damage Score

0.0792

Coding Region Coverage

1x: 99.2%
3x: 98.5%
10x: 96.9%
20x: 94.8%

Validation Efficiency

94% (79/84)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] L-glutamate is the major excitatory neurotransmitter in the central nervous system and activates both ionotropic and metabotropic glutamate receptors. Glutamatergic neurotransmission is involved in most aspects of normal brain function and can be perturbed in many neuropathologic conditions. The metabotropic glutamate receptors are a family of G protein-coupled receptors, that have been divided into 3 groups on the basis of sequence homology, putative signal transduction mechanisms, and pharmacologic properties. Group I includes GRM1 and GRM5 and these receptors have been shown to activate phospholipase C. Group II includes GRM2 and GRM3 while Group III includes GRM4, GRM6, GRM7 and GRM8. Group II and III receptors are linked to the inhibition of the cyclic AMP cascade but differ in their agonist selectivities. Several transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Feb 2012]
PHENOTYPE: Homozygous mutation of theis gene results in impaired motor learning, and reduced paired-pulse facilitation and post-tetanic potential. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 79 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2610028H24Rik	A	G	10: 76,457,512	M156V	probably benign	Het
Adnp2	A	T	18: 80,129,745	V483D	probably damaging	Het
Aff1	G	T	5: 103,828,484	E491*	probably null	Het
Agl	A	T	3: 116,776,608	C911*	probably null	Het
Akt2	A	G	7: 27,636,058	D284G	probably damaging	Het
Alox15	A	G	11: 70,349,635	M240T	possibly damaging	Het
Antxr2	A	G	5: 97,979,985	V229A	probably damaging	Het
Arap2	G	A	5: 62,683,484	L680F	probably damaging	Het
Btaf1	A	G	19: 36,958,373	T188A	probably benign	Het
Btnl6	G	A	17: 34,515,531	Q86*	probably null	Het
C2cd3	T	A	7: 100,416,062	L685H	probably damaging	Het
Cdh23	T	C	10: 60,413,173	T878A	possibly damaging	Het
Clec4b2	T	C	6: 123,202,149	Y137H	probably damaging	Het
Dchs1	T	A	7: 105,755,836	T2500S	possibly damaging	Het
Def6	A	G	17: 28,217,092	Y75C	probably damaging	Het
Dhx33	A	T	11: 70,993,635	F448L	probably damaging	Het
Dner	C	T	1: 84,494,893		probably benign	Het
Dnmbp	G	A	19: 43,902,231	P366S	probably benign	Het
Eif4g3	T	C	4: 138,175,848	C1160R	possibly damaging	Het
Elmod1	G	A	9: 53,912,901		probably benign	Het
Faah	C	A	4: 116,004,391	L305F	probably damaging	Het
Fam71b	A	G	11: 46,406,804	T312A	unknown	Het
Flt1	A	G	5: 147,571,014		probably benign	Het
Fyco1	A	T	9: 123,822,406	N1196K	probably benign	Het
Galnt18	T	C	7: 111,554,457	N320S	probably damaging	Het
Glp2r	C	A	11: 67,709,712	G437V	possibly damaging	Het
Gm4884	T	C	7: 41,044,292	S562P	probably damaging	Het
Gm9936	A	G	5: 114,857,347		probably benign	Het
Gpn2	C	A	4: 133,584,792	P112T	probably damaging	Het
Helz2	A	T	2: 181,240,959	S14T	probably benign	Het
Htt	T	C	5: 34,820,104	L778P	probably benign	Het
Il11ra1	T	C	4: 41,765,060	S129P	probably damaging	Het
Ints11	T	C	4: 155,887,168	F315S	probably damaging	Het
Itga11	A	T	9: 62,776,613	N1059Y	possibly damaging	Het
Jak3	A	G	8: 71,684,327	S716G	probably damaging	Het
Kcns1	G	T	2: 164,168,643	D65E	probably benign	Het
Kdm5d	A	T	Y: 941,715	K1305N	probably benign	Het
Kif26a	G	T	12: 112,177,880	V1523L	probably benign	Het
Mboat7	A	G	7: 3,683,822	S340P	probably damaging	Het
Mctp2	T	C	7: 72,229,408	I234V	probably benign	Het
Mex3c	G	A	18: 73,590,551	A572T	probably benign	Het
Mpp3	C	A	11: 102,005,425	R424L	probably benign	Het
Mroh4	T	A	15: 74,608,237		probably benign	Het
Myo9a	A	T	9: 59,860,206		probably benign	Het
Myog	T	A	1: 134,290,235	H60Q	probably damaging	Het
Nlrp9a	T	A	7: 26,571,225		probably null	Het
Notch1	A	G	2: 26,473,818	V868A	possibly damaging	Het
Olfr352	A	G	2: 36,870,160	N198S	probably damaging	Het
Olfr59	T	A	11: 74,289,051	I135N	possibly damaging	Het
Olfr73	T	C	2: 88,034,266	Y291C	possibly damaging	Het
Olfr980	A	T	9: 40,006,355	I198N	probably damaging	Het
Pink1	T	C	4: 138,317,401	T342A	probably benign	Het
Plb1	T	A	5: 32,349,615		probably benign	Het
Plec	T	C	15: 76,178,246	D2524G	probably damaging	Het
Plekhg4	G	T	8: 105,375,396	E6*	probably null	Het
Polq	T	C	16: 37,061,839	F1455S	possibly damaging	Het
Ppm1e	A	G	11: 87,249,058		probably benign	Het
Prkaca	G	A	8: 83,988,303	M119I	possibly damaging	Het
Prss46	G	T	9: 110,850,055	S108I	probably damaging	Het
Ptma	C	T	1: 86,529,776		probably benign	Het
Rab11fip4	C	T	11: 79,689,653	T437M	probably benign	Het
Rngtt	T	A	4: 33,379,409	M437K	probably benign	Het
Rrn3	T	A	16: 13,813,113	D604E	possibly damaging	Het
Scn4a	A	G	11: 106,348,405		probably benign	Het
Sis	A	G	3: 72,910,476	L1468P	possibly damaging	Het
Slit3	A	G	11: 35,707,918	M1450V	probably benign	Het
Smg5	T	C	3: 88,349,233	S269P	probably benign	Het
Sntg1	T	C	1: 8,463,462	T323A	probably damaging	Het
Son	C	T	16: 91,651,662	T37I	probably damaging	Het
Stk17b	T	C	1: 53,764,132	I41M	probably benign	Het
Tgm5	T	A	2: 121,076,882	Y120F	probably damaging	Het
Tppp	A	G	13: 74,021,360	K73R	possibly damaging	Het
Ttn	C	A	2: 76,739,158	K27130N	probably damaging	Het
Ttn	C	T	2: 76,907,752	V4148I	probably benign	Het
Uba7	A	T	9: 107,978,249	Y375F	probably damaging	Het
Ugcg	T	C	4: 59,213,931	L171P	possibly damaging	Het
Vsig2	T	C	9: 37,542,576		probably benign	Het
Zcchc11	T	A	4: 108,530,955		probably benign	Het
Zfp839	T	A	12: 110,868,386	S692T	possibly damaging	Het

Other mutations in Grm4

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01154:Grm4	APN	17	27434737	nonsense	probably null
IGL02380:Grm4	APN	17	27434661	missense	probably damaging	1.00
IGL03244:Grm4	APN	17	27434823	missense	probably damaging	0.99
R0352:Grm4	UTSW	17	27451891	splice site	probably benign
R0599:Grm4	UTSW	17	27431490	missense	probably benign	0.39
R0616:Grm4	UTSW	17	27434564	missense	probably damaging	1.00
R0645:Grm4	UTSW	17	27435209	missense	probably damaging	1.00
R0726:Grm4	UTSW	17	27438438	splice site	probably benign
R1085:Grm4	UTSW	17	27473033	missense	probably damaging	1.00
R1486:Grm4	UTSW	17	27434717	missense	probably damaging	1.00
R1535:Grm4	UTSW	17	27434801	missense	probably benign	0.01
R1799:Grm4	UTSW	17	27472940	missense	probably damaging	0.99
R1914:Grm4	UTSW	17	27434712	missense	probably damaging	0.99
R2472:Grm4	UTSW	17	27434675	missense	probably damaging	1.00
R3759:Grm4	UTSW	17	27435299	missense	probably benign	0.00
R4244:Grm4	UTSW	17	27502735	missense	probably damaging	1.00
R5390:Grm4	UTSW	17	27434738	missense	probably damaging	1.00
R5476:Grm4	UTSW	17	27434798	missense	probably benign	0.04
R5516:Grm4	UTSW	17	27438411	missense	probably benign	0.06
R5897:Grm4	UTSW	17	27435163	missense	probably benign	0.02
R5956:Grm4	UTSW	17	27435155	missense	probably benign	0.01
R6391:Grm4	UTSW	17	27435320	missense	probably benign	0.00
R7330:Grm4	UTSW	17	27434824	nonsense	probably null
R7449:Grm4	UTSW	17	27435371	missense	probably damaging	1.00
R8338:Grm4	UTSW	17	27435003	missense	probably damaging	1.00
R8734:Grm4	UTSW	17	27438791	missense	probably damaging	1.00
R8899:Grm4	UTSW	17	27434780	missense	probably damaging	1.00
R9157:Grm4	UTSW	17	27434982	missense	probably benign	0.21
R9203:Grm4	UTSW	17	27435006	missense	probably benign	0.04
R9267:Grm4	UTSW	17	27435209	missense	possibly damaging	0.86
R9292:Grm4	UTSW	17	27473063	missense	probably damaging	1.00
R9344:Grm4	UTSW	17	27434763	missense	probably benign	0.09
R9578:Grm4	UTSW	17	27450209	missense	possibly damaging	0.56
R9746:Grm4	UTSW	17	27438791	missense	probably damaging	1.00
R9762:Grm4	UTSW	17	27502714	missense	probably damaging	1.00
Z1177:Grm4	UTSW	17	27450194	nonsense	probably null
Z1177:Grm4	UTSW	17	27450221	missense	probably benign	0.12

Predicted Primers

PCR Primer
(F):5'- GCCCTTCTGTGTGAACTTGTTGGAC -3'
(R):5'- ACACCTGACACTGTTGACTCTGCC -3'

Sequencing Primer
(F):5'- AACTTGTTGGACATGGTGGC -3'
(R):5'- ataaggacacaggcacgag -3'

Posted On

2013-05-09