Incidental Mutation 'R0013:Zfp839'
ID32662
Institutional Source Beutler Lab
Gene Symbol Zfp839
Ensembl Gene ENSMUSG00000021271
Gene Namezinc finger protein 839
Synonyms2810455K09Rik
MMRRC Submission 038308-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.079) question?
Stock #R0013 (G1)
Quality Score225
Status Validated
Chromosome12
Chromosomal Location110850253-110869996 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 110868386 bp
ZygosityHeterozygous
Amino Acid Change Serine to Threonine at position 692 (S692T)
Ref Sequence ENSEMBL: ENSMUSP00000131841 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000043716] [ENSMUST00000170060] [ENSMUST00000220607] [ENSMUST00000222460]
Predicted Effect probably benign
Transcript: ENSMUST00000043716
SMART Domains Protein: ENSMUSP00000035245
Gene: ENSMUSG00000021276

DomainStartEndE-ValueType
low complexity region 54 78 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000170060
AA Change: S692T

PolyPhen 2 Score 0.661 (Sensitivity: 0.86; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000131841
Gene: ENSMUSG00000021271
AA Change: S692T

DomainStartEndE-ValueType
low complexity region 271 278 N/A INTRINSIC
ZnF_C2H2 295 320 3.02e0 SMART
low complexity region 377 388 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000220607
Predicted Effect possibly damaging
Transcript: ENSMUST00000222460
AA Change: S616T

PolyPhen 2 Score 0.548 (Sensitivity: 0.88; Specificity: 0.91)
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.8%
Validation Efficiency 94% (79/84)
Allele List at MGI
Other mutations in this stock
Total: 79 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610028H24Rik A G 10: 76,457,512 M156V probably benign Het
Adnp2 A T 18: 80,129,745 V483D probably damaging Het
Aff1 G T 5: 103,828,484 E491* probably null Het
Agl A T 3: 116,776,608 C911* probably null Het
Akt2 A G 7: 27,636,058 D284G probably damaging Het
Alox15 A G 11: 70,349,635 M240T possibly damaging Het
Antxr2 A G 5: 97,979,985 V229A probably damaging Het
Arap2 G A 5: 62,683,484 L680F probably damaging Het
Btaf1 A G 19: 36,958,373 T188A probably benign Het
Btnl6 G A 17: 34,515,531 Q86* probably null Het
C2cd3 T A 7: 100,416,062 L685H probably damaging Het
Cdh23 T C 10: 60,413,173 T878A possibly damaging Het
Clec4b2 T C 6: 123,202,149 Y137H probably damaging Het
Dchs1 T A 7: 105,755,836 T2500S possibly damaging Het
Def6 A G 17: 28,217,092 Y75C probably damaging Het
Dhx33 A T 11: 70,993,635 F448L probably damaging Het
Dner C T 1: 84,494,893 probably benign Het
Dnmbp G A 19: 43,902,231 P366S probably benign Het
Eif4g3 T C 4: 138,175,848 C1160R possibly damaging Het
Elmod1 G A 9: 53,912,901 probably benign Het
Faah C A 4: 116,004,391 L305F probably damaging Het
Fam71b A G 11: 46,406,804 T312A unknown Het
Flt1 A G 5: 147,571,014 probably benign Het
Fyco1 A T 9: 123,822,406 N1196K probably benign Het
Galnt18 T C 7: 111,554,457 N320S probably damaging Het
Glp2r C A 11: 67,709,712 G437V possibly damaging Het
Gm4884 T C 7: 41,044,292 S562P probably damaging Het
Gm9936 A G 5: 114,857,347 probably benign Het
Gpn2 C A 4: 133,584,792 P112T probably damaging Het
Grm4 A G 17: 27,431,575 Y816H probably benign Het
Helz2 A T 2: 181,240,959 S14T probably benign Het
Htt T C 5: 34,820,104 L778P probably benign Het
Il11ra1 T C 4: 41,765,060 S129P probably damaging Het
Ints11 T C 4: 155,887,168 F315S probably damaging Het
Itga11 A T 9: 62,776,613 N1059Y possibly damaging Het
Jak3 A G 8: 71,684,327 S716G probably damaging Het
Kcns1 G T 2: 164,168,643 D65E probably benign Het
Kdm5d A T Y: 941,715 K1305N probably benign Het
Kif26a G T 12: 112,177,880 V1523L probably benign Het
Mboat7 A G 7: 3,683,822 S340P probably damaging Het
Mctp2 T C 7: 72,229,408 I234V probably benign Het
Mex3c G A 18: 73,590,551 A572T probably benign Het
Mpp3 C A 11: 102,005,425 R424L probably benign Het
Mroh4 T A 15: 74,608,237 probably benign Het
Myo9a A T 9: 59,860,206 probably benign Het
Myog T A 1: 134,290,235 H60Q probably damaging Het
Nlrp9a T A 7: 26,571,225 probably null Het
Notch1 A G 2: 26,473,818 V868A possibly damaging Het
Olfr352 A G 2: 36,870,160 N198S probably damaging Het
Olfr59 T A 11: 74,289,051 I135N possibly damaging Het
Olfr73 T C 2: 88,034,266 Y291C possibly damaging Het
Olfr980 A T 9: 40,006,355 I198N probably damaging Het
Pink1 T C 4: 138,317,401 T342A probably benign Het
Plb1 T A 5: 32,349,615 probably benign Het
Plec T C 15: 76,178,246 D2524G probably damaging Het
Plekhg4 G T 8: 105,375,396 E6* probably null Het
Polq T C 16: 37,061,839 F1455S possibly damaging Het
Ppm1e A G 11: 87,249,058 probably benign Het
Prkaca G A 8: 83,988,303 M119I possibly damaging Het
Prss46 G T 9: 110,850,055 S108I probably damaging Het
Ptma C T 1: 86,529,776 probably benign Het
Rab11fip4 C T 11: 79,689,653 T437M probably benign Het
Rngtt T A 4: 33,379,409 M437K probably benign Het
Rrn3 T A 16: 13,813,113 D604E possibly damaging Het
Scn4a A G 11: 106,348,405 probably benign Het
Sis A G 3: 72,910,476 L1468P possibly damaging Het
Slit3 A G 11: 35,707,918 M1450V probably benign Het
Smg5 T C 3: 88,349,233 S269P probably benign Het
Sntg1 T C 1: 8,463,462 T323A probably damaging Het
Son C T 16: 91,651,662 T37I probably damaging Het
Stk17b T C 1: 53,764,132 I41M probably benign Het
Tgm5 T A 2: 121,076,882 Y120F probably damaging Het
Tppp A G 13: 74,021,360 K73R possibly damaging Het
Ttn C A 2: 76,739,158 K27130N probably damaging Het
Ttn C T 2: 76,907,752 V4148I probably benign Het
Uba7 A T 9: 107,978,249 Y375F probably damaging Het
Ugcg T C 4: 59,213,931 L171P possibly damaging Het
Vsig2 T C 9: 37,542,576 probably benign Het
Zcchc11 T A 4: 108,530,955 probably benign Het
Other mutations in Zfp839
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00821:Zfp839 APN 12 110865007 critical splice donor site probably null
IGL00941:Zfp839 APN 12 110860948 missense probably damaging 1.00
R0013:Zfp839 UTSW 12 110868386 missense possibly damaging 0.66
R0109:Zfp839 UTSW 12 110860874 missense possibly damaging 0.92
R0116:Zfp839 UTSW 12 110858769 intron probably benign
R1219:Zfp839 UTSW 12 110868273 missense possibly damaging 0.63
R1406:Zfp839 UTSW 12 110866310 missense probably damaging 0.99
R1406:Zfp839 UTSW 12 110866310 missense probably damaging 0.99
R1434:Zfp839 UTSW 12 110860899 missense probably benign 0.08
R1653:Zfp839 UTSW 12 110855250 missense probably benign 0.02
R1754:Zfp839 UTSW 12 110855457 missense probably damaging 0.98
R2182:Zfp839 UTSW 12 110868338 missense probably damaging 1.00
R3765:Zfp839 UTSW 12 110855163 missense probably benign 0.22
R3981:Zfp839 UTSW 12 110866331 missense probably damaging 0.97
R4756:Zfp839 UTSW 12 110855201 missense possibly damaging 0.92
R5088:Zfp839 UTSW 12 110868176 missense probably damaging 0.99
R5394:Zfp839 UTSW 12 110855586 missense probably benign 0.05
R5619:Zfp839 UTSW 12 110864036 missense probably damaging 1.00
R6856:Zfp839 UTSW 12 110866761 nonsense probably null
R7661:Zfp839 UTSW 12 110868792 missense probably benign 0.32
R7860:Zfp839 UTSW 12 110855626 missense probably damaging 1.00
R8022:Zfp839 UTSW 12 110855098 missense probably damaging 1.00
Z1177:Zfp839 UTSW 12 110866784 missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- TGCTAGTGACAGAAATGCACCACC -3'
(R):5'- GCAGCAAGATGTTCACAGGCACAG -3'

Sequencing Primer
(F):5'- TGAAGCTAGGAATGGCTCTG -3'
(R):5'- TCACAGGCACAGTGTTATGG -3'
Posted On2013-05-09