Incidental Mutation 'R4473:Rab22a'
ID330447
Institutional Source Beutler Lab
Gene Symbol Rab22a
Ensembl Gene ENSMUSG00000027519
Gene NameRAB22A, member RAS oncogene family
SynonymsRab22, E130120E14Rik, 3732413A17Rik
MMRRC Submission 041730-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4473 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location173659760-173707343 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 173695263 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Methionine at position 85 (T85M)
Ref Sequence ENSEMBL: ENSMUSP00000104738 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029024] [ENSMUST00000109110] [ENSMUST00000142820]
Predicted Effect probably damaging
Transcript: ENSMUST00000029024
AA Change: T92M

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000029024
Gene: ENSMUSG00000027519
AA Change: T92M

DomainStartEndE-ValueType
RAB 6 169 1.96e-72 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000109110
AA Change: T85M

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000104738
Gene: ENSMUSG00000027519
AA Change: T85M

DomainStartEndE-ValueType
Pfam:Arf 1 159 2.7e-8 PFAM
Pfam:Miro 7 114 4.3e-14 PFAM
Pfam:Ras 7 161 2e-41 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000142820
AA Change: R65C

PolyPhen 2 Score 0.754 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000122799
Gene: ENSMUSG00000027519
AA Change: R65C

DomainStartEndE-ValueType
Pfam:Ras 7 61 1.1e-11 PFAM
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.9%
Validation Efficiency 100% (36/36)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the RAB family of small GTPases. The GTP-bound form of the encoded protein has been shown to interact with early-endosomal antigen 1, and may be involved in the trafficking of and interaction between endosomal compartments. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 31 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acot7 C A 4: 152,206,856 T93K probably damaging Het
Actg1 G A 11: 120,348,259 R2C probably benign Het
Alb T C 5: 90,464,053 C114R probably damaging Het
Alpk1 T C 3: 127,680,018 T779A probably damaging Het
Atp2a2 A T 5: 122,457,264 S1008T probably benign Het
Corin T C 5: 72,339,057 S510G probably damaging Het
D630003M21Rik G A 2: 158,213,462 P585L probably damaging Het
Eddm3b A G 14: 51,116,779 T75A probably benign Het
Elavl2 T C 4: 91,261,009 probably null Het
Erc1 G T 6: 119,848,456 probably null Het
Fancf A G 7: 51,862,200 C19R probably benign Het
Fastkd2 T C 1: 63,731,674 L63P probably damaging Het
Fmo1 A G 1: 162,850,163 V128A possibly damaging Het
Gm3106 A G 5: 94,218,170 N49S probably benign Het
Ifnar1 T C 16: 91,495,170 V133A probably damaging Het
Ighv1-49 A T 12: 115,055,339 Y79N probably damaging Het
Klhl23 A G 2: 69,823,807 E7G possibly damaging Het
Mthfd2 A G 6: 83,310,535 probably benign Het
Olfr1161 T A 2: 88,025,120 Y133N probably damaging Het
Parn A G 16: 13,664,685 S100P probably benign Het
Podnl1 A T 8: 84,131,985 I505F possibly damaging Het
Ppp6r3 G T 19: 3,511,978 Q228K probably damaging Het
Siah1b G A X: 164,071,692 P131S probably damaging Het
Skor2 C T 18: 76,859,461 P293S unknown Het
Sox18 T C 2: 181,670,876 K154R probably damaging Het
Tfpi A T 2: 84,458,082 L10Q probably null Het
Trim66 A T 7: 109,481,995 I239N probably damaging Het
Ttll1 T A 15: 83,492,609 K304N probably damaging Het
Vmn1r5 G A 6: 56,985,648 V103I probably benign Het
Vnn1 T C 10: 23,894,891 W6R probably benign Het
Wdr35 A G 12: 9,015,995 Y651C probably benign Het
Other mutations in Rab22a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01061:Rab22a APN 2 173688210 missense probably damaging 1.00
IGL01889:Rab22a APN 2 173688238 intron probably benign
IGL03113:Rab22a APN 2 173661472 missense probably damaging 1.00
PIT1430001:Rab22a UTSW 2 173695170 missense probably benign 0.09
R0304:Rab22a UTSW 2 173661459 missense probably damaging 1.00
R1937:Rab22a UTSW 2 173688211 missense probably damaging 1.00
R2914:Rab22a UTSW 2 173695281 missense probably benign 0.00
R4474:Rab22a UTSW 2 173695263 missense probably damaging 1.00
R4476:Rab22a UTSW 2 173695263 missense probably damaging 1.00
R4559:Rab22a UTSW 2 173661433 missense probably damaging 1.00
R5163:Rab22a UTSW 2 173661487 missense probably damaging 0.99
R5934:Rab22a UTSW 2 173661504 missense probably damaging 1.00
R6753:Rab22a UTSW 2 173701055 missense probably benign
R7654:Rab22a UTSW 2 173688175 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- CTTTTGTGCAGGGATAATGGAC -3'
(R):5'- ACCCTGGATGTGGCTCATTAG -3'

Sequencing Primer
(F):5'- GCTAAAAGGACATCTTTCCCTG -3'
(R):5'- CCCTGGATGTGGCTCATTAGAAAAG -3'
Posted On2015-07-21