Incidental Mutation 'R4523:Prr12'
ID334305
Institutional Source Beutler Lab
Gene Symbol Prr12
Ensembl Gene ENSMUSG00000046574
Gene Nameproline rich 12
Synonyms
MMRRC Submission 042004-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.385) question?
Stock #R4523 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location45027563-45052881 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 45048523 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 656 (D656G)
Ref Sequence ENSEMBL: ENSMUSP00000054702 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000057293]
Predicted Effect unknown
Transcript: ENSMUST00000057293
AA Change: D656G
SMART Domains Protein: ENSMUSP00000054702
Gene: ENSMUSG00000046574
AA Change: D656G

DomainStartEndE-ValueType
low complexity region 135 150 N/A INTRINSIC
low complexity region 208 222 N/A INTRINSIC
low complexity region 225 242 N/A INTRINSIC
low complexity region 249 261 N/A INTRINSIC
low complexity region 330 376 N/A INTRINSIC
low complexity region 388 413 N/A INTRINSIC
low complexity region 418 444 N/A INTRINSIC
low complexity region 450 464 N/A INTRINSIC
low complexity region 469 487 N/A INTRINSIC
low complexity region 535 559 N/A INTRINSIC
low complexity region 598 616 N/A INTRINSIC
low complexity region 665 682 N/A INTRINSIC
low complexity region 760 775 N/A INTRINSIC
low complexity region 785 814 N/A INTRINSIC
low complexity region 830 841 N/A INTRINSIC
low complexity region 858 871 N/A INTRINSIC
low complexity region 883 896 N/A INTRINSIC
low complexity region 949 960 N/A INTRINSIC
low complexity region 964 986 N/A INTRINSIC
low complexity region 1033 1044 N/A INTRINSIC
low complexity region 1059 1070 N/A INTRINSIC
AT_hook 1161 1173 5.74e1 SMART
AT_hook 1193 1205 8.09e0 SMART
low complexity region 1252 1264 N/A INTRINSIC
low complexity region 1308 1328 N/A INTRINSIC
low complexity region 1417 1535 N/A INTRINSIC
low complexity region 1684 1748 N/A INTRINSIC
Pfam:DUF4211 1817 1950 6.5e-21 PFAM
Meta Mutation Damage Score 0.0832 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.2%
Validation Efficiency 100% (61/61)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a proline-rich protein that contains two A-T hook DNA binding domains. A chromosomal translocation and gene fusion between this gene and zinc finger, MIZ-type containing 1 (Gene ID: 57178) may underlie intellectual disability and neuropsychiatric problems in a human patient. Enriched expression of this gene in embryonic mouse brain suggests that this gene may play a role in nervous system development. [provided by RefSeq, Jul 2016]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Atp8a1 G T 5: 67,667,600 T796K probably benign Het
Atr T C 9: 95,862,863 S78P probably damaging Het
BC017643 A G 11: 121,224,108 probably benign Het
Calb2 C T 8: 110,148,509 probably null Het
Ccdc88c G T 12: 100,913,332 S1843R possibly damaging Het
Cdca7 A G 2: 72,479,698 S77G probably damaging Het
Cnot2 C T 10: 116,581,474 probably benign Het
Cstf2t T A 19: 31,083,082 V6D possibly damaging Het
Dido1 T C 2: 180,672,292 I852V probably damaging Het
Dmgdh C T 13: 93,688,630 Q154* probably null Het
Dnah12 T C 14: 26,770,022 F1138S probably damaging Het
Dnah12 G A 14: 26,876,958 A998T possibly damaging Het
Dusp5 T G 19: 53,537,601 Y225D probably damaging Het
Fam122c G A X: 53,293,499 R94H possibly damaging Het
Fam126a T C 5: 23,965,122 T410A probably benign Het
Fam193a G A 5: 34,443,371 D601N probably benign Het
Fbxo41 A G 6: 85,484,042 I228T probably damaging Het
Fmo2 T C 1: 162,887,708 K115R probably benign Het
Gak G T 5: 108,576,566 Q1093K probably benign Het
Gm5277 G T 3: 78,892,186 noncoding transcript Het
Gm7173 A T X: 79,509,995 N291K possibly damaging Het
Hgsnat A G 8: 25,968,361 probably null Het
Map3k3 G A 11: 106,148,868 R278H probably damaging Het
Mrvi1 T C 7: 110,923,841 M338V probably benign Het
Muc4 T C 16: 32,736,336 probably benign Het
Nectin3 C A 16: 46,448,590 R483L probably benign Het
Nop2 G T 6: 125,133,552 R47L probably damaging Het
Ntng1 A G 3: 109,934,996 S154P probably damaging Het
Olfml2b T C 1: 170,669,222 I474T probably benign Het
Olfr1054 C G 2: 86,333,300 D19H probably benign Het
Olfr843 T C 9: 19,249,229 T57A probably damaging Het
Optc G T 1: 133,903,754 T138K possibly damaging Het
Orc4 G A 2: 48,937,489 P31S probably benign Het
Pard3 C T 8: 127,398,627 P421S probably benign Het
Pcdhb22 G T 18: 37,520,421 E647D probably benign Het
Pclo A G 5: 14,679,992 probably benign Het
Prkce G T 17: 86,490,750 probably null Het
Ptprk A T 10: 28,466,052 D485V probably damaging Het
Ptprn2 T C 12: 116,876,000 L381P probably damaging Het
Rnf144b T C 13: 47,207,537 I51T probably benign Het
Rpl10l T C 12: 66,283,738 D207G probably benign Het
Sh3glb2 A T 2: 30,350,699 V118E probably damaging Het
Sipa1l2 C T 8: 125,492,424 G58D probably damaging Het
Slc5a4a C T 10: 76,148,362 A46V probably damaging Het
Tepp T A 8: 95,313,010 Y18* probably null Het
Tgm7 C A 2: 121,098,588 probably null Het
Tjap1 A G 17: 46,258,792 V424A probably benign Het
Trpm6 A T 19: 18,796,500 I414F probably damaging Het
Tsr3 C G 17: 25,241,749 D196E probably benign Het
Ubqlnl C T 7: 104,149,718 V191M probably benign Het
Vmn2r72 T A 7: 85,751,926 H95L probably benign Het
Vmn2r97 T A 17: 18,929,071 N240K probably benign Het
Xdh C A 17: 73,898,344 G1042V probably damaging Het
Zcchc4 A G 5: 52,784,067 D68G probably damaging Het
Other mutations in Prr12
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01144:Prr12 APN 7 45047458 missense unknown
IGL01603:Prr12 APN 7 45043485 missense probably damaging 0.96
IGL01941:Prr12 APN 7 45048659 unclassified probably benign
IGL02043:Prr12 APN 7 45050005 unclassified probably benign
IGL02170:Prr12 APN 7 45046188 missense unknown
IGL02494:Prr12 APN 7 45028846 missense unknown
IGL02947:Prr12 APN 7 45048556 missense unknown
R0128:Prr12 UTSW 7 45050039 unclassified probably benign
R0255:Prr12 UTSW 7 45049991 unclassified probably benign
R0556:Prr12 UTSW 7 45030669 missense unknown
R1168:Prr12 UTSW 7 45029047 missense unknown
R1266:Prr12 UTSW 7 45050253 unclassified probably benign
R1374:Prr12 UTSW 7 45046218 missense unknown
R1531:Prr12 UTSW 7 45028530 missense unknown
R1537:Prr12 UTSW 7 45028942 missense unknown
R1572:Prr12 UTSW 7 45028800 missense unknown
R1617:Prr12 UTSW 7 45049594 unclassified probably benign
R1647:Prr12 UTSW 7 45034192 missense probably benign 0.20
R1694:Prr12 UTSW 7 45028579 missense unknown
R1732:Prr12 UTSW 7 45048356 missense unknown
R1819:Prr12 UTSW 7 45048697 unclassified probably benign
R2114:Prr12 UTSW 7 45046082 missense unknown
R2210:Prr12 UTSW 7 45049351 unclassified probably benign
R2846:Prr12 UTSW 7 45046012 missense unknown
R2902:Prr12 UTSW 7 45047612 missense unknown
R2985:Prr12 UTSW 7 45046012 missense unknown
R4094:Prr12 UTSW 7 45047947 missense unknown
R4498:Prr12 UTSW 7 45045914 missense unknown
R4763:Prr12 UTSW 7 45047695 missense unknown
R4775:Prr12 UTSW 7 45051325 unclassified probably benign
R4995:Prr12 UTSW 7 45051229 unclassified probably benign
R5007:Prr12 UTSW 7 45049801 unclassified probably benign
R5045:Prr12 UTSW 7 45049894 unclassified probably benign
R5184:Prr12 UTSW 7 45046377 missense unknown
R5897:Prr12 UTSW 7 45043384 missense probably damaging 1.00
R6847:Prr12 UTSW 7 45045740 missense unknown
R6912:Prr12 UTSW 7 45048845 unclassified probably benign
R7147:Prr12 UTSW 7 45033850 missense unknown
R8120:Prr12 UTSW 7 45034742 missense probably damaging 1.00
R8292:Prr12 UTSW 7 45034688 missense probably damaging 1.00
X0066:Prr12 UTSW 7 45047003 missense unknown
Z1176:Prr12 UTSW 7 45052856 missense unknown
Z1177:Prr12 UTSW 7 45050286 missense unknown
Predicted Primers PCR Primer
(F):5'- TGAACGACTGAGGTGGCTAGTC -3'
(R):5'- AGTTCGGTCTTAGCCTCAGC -3'

Sequencing Primer
(F):5'- GCTAGTCCCTCGGGAGTTTC -3'
(R):5'- TCAGCTCCGTTCCTGGCG -3'
Posted On2015-08-18