Incidental Mutation 'R4523:Tjap1'
ID334333
Institutional Source Beutler Lab
Gene Symbol Tjap1
Ensembl Gene ENSMUSG00000012296
Gene Nametight junction associated protein 1
Synonyms0610041D19Rik, Tjp4, Pilt
MMRRC Submission 042004-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.230) question?
Stock #R4523 (G1)
Quality Score225
Status Validated
Chromosome17
Chromosomal Location46257851-46283026 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 46258792 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 424 (V424A)
Ref Sequence ENSEMBL: ENSMUSP00000153632 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000012440] [ENSMUST00000095262] [ENSMUST00000164342] [ENSMUST00000180283] [ENSMUST00000224055] [ENSMUST00000224230] [ENSMUST00000224901] [ENSMUST00000225080] [ENSMUST00000225288] [ENSMUST00000225359] [ENSMUST00000225413] [ENSMUST00000225943]
Predicted Effect probably benign
Transcript: ENSMUST00000012440
AA Change: V414A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000012440
Gene: ENSMUSG00000012296
AA Change: V414A

DomainStartEndE-ValueType
low complexity region 4 16 N/A INTRINSIC
SCOP:d1fxkc_ 28 158 6e-3 SMART
low complexity region 204 215 N/A INTRINSIC
Pfam:Pilt 256 450 3.7e-83 PFAM
Pfam:Pilt 441 538 5.4e-31 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000095262
SMART Domains Protein: ENSMUSP00000092896
Gene: ENSMUSG00000071073

DomainStartEndE-ValueType
LRR 27 54 2.42e1 SMART
LRR 84 111 3.47e1 SMART
LRR 112 139 1.84e0 SMART
LRR 143 171 1.66e2 SMART
LRR 172 199 5.41e0 SMART
LRR 200 227 3.54e0 SMART
LRR 229 256 5.48e1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000164342
AA Change: V414A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000130710
Gene: ENSMUSG00000012296
AA Change: V414A

DomainStartEndE-ValueType
low complexity region 4 16 N/A INTRINSIC
SCOP:d1fxkc_ 28 158 6e-3 SMART
low complexity region 204 215 N/A INTRINSIC
Pfam:Pilt 262 447 1.5e-59 PFAM
Pfam:Pilt 442 538 1.1e-22 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000180283
AA Change: V414A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000137220
Gene: ENSMUSG00000012296
AA Change: V414A

DomainStartEndE-ValueType
low complexity region 4 16 N/A INTRINSIC
SCOP:d1fxkc_ 28 158 6e-3 SMART
low complexity region 204 215 N/A INTRINSIC
Pfam:Pilt 256 450 3.7e-83 PFAM
Pfam:Pilt 441 538 5.4e-31 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000224055
Predicted Effect probably benign
Transcript: ENSMUST00000224230
Predicted Effect noncoding transcript
Transcript: ENSMUST00000224404
Predicted Effect noncoding transcript
Transcript: ENSMUST00000224696
Predicted Effect probably benign
Transcript: ENSMUST00000224901
Predicted Effect probably benign
Transcript: ENSMUST00000225080
AA Change: V414A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Predicted Effect probably benign
Transcript: ENSMUST00000225288
Predicted Effect probably benign
Transcript: ENSMUST00000225359
Predicted Effect probably benign
Transcript: ENSMUST00000225413
AA Change: V424A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Predicted Effect probably benign
Transcript: ENSMUST00000225943
Predicted Effect noncoding transcript
Transcript: ENSMUST00000225915
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.2%
Validation Efficiency 100% (61/61)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a tight junction-associated protein. Incorporation of the encoded protein into tight junctions occurs at a late stage of formation of the junctions. The encoded protein localizes to the Golgi and may function in vesicle trafficking. Alternatively spliced transcript variants have been described. A related pseudogene exists on the X chromosome. [provided by RefSeq, Mar 2009]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Atp8a1 G T 5: 67,667,600 T796K probably benign Het
Atr T C 9: 95,862,863 S78P probably damaging Het
BC017643 A G 11: 121,224,108 probably benign Het
Calb2 C T 8: 110,148,509 probably null Het
Ccdc88c G T 12: 100,913,332 S1843R possibly damaging Het
Cdca7 A G 2: 72,479,698 S77G probably damaging Het
Cnot2 C T 10: 116,581,474 probably benign Het
Cstf2t T A 19: 31,083,082 V6D possibly damaging Het
Dido1 T C 2: 180,672,292 I852V probably damaging Het
Dmgdh C T 13: 93,688,630 Q154* probably null Het
Dnah12 T C 14: 26,770,022 F1138S probably damaging Het
Dnah12 G A 14: 26,876,958 A998T possibly damaging Het
Dusp5 T G 19: 53,537,601 Y225D probably damaging Het
Fam122c G A X: 53,293,499 R94H possibly damaging Het
Fam126a T C 5: 23,965,122 T410A probably benign Het
Fam193a G A 5: 34,443,371 D601N probably benign Het
Fbxo41 A G 6: 85,484,042 I228T probably damaging Het
Fmo2 T C 1: 162,887,708 K115R probably benign Het
Gak G T 5: 108,576,566 Q1093K probably benign Het
Gm5277 G T 3: 78,892,186 noncoding transcript Het
Gm7173 A T X: 79,509,995 N291K possibly damaging Het
Hgsnat A G 8: 25,968,361 probably null Het
Map3k3 G A 11: 106,148,868 R278H probably damaging Het
Mrvi1 T C 7: 110,923,841 M338V probably benign Het
Muc4 T C 16: 32,736,336 probably benign Het
Nectin3 C A 16: 46,448,590 R483L probably benign Het
Nop2 G T 6: 125,133,552 R47L probably damaging Het
Ntng1 A G 3: 109,934,996 S154P probably damaging Het
Olfml2b T C 1: 170,669,222 I474T probably benign Het
Olfr1054 C G 2: 86,333,300 D19H probably benign Het
Olfr843 T C 9: 19,249,229 T57A probably damaging Het
Optc G T 1: 133,903,754 T138K possibly damaging Het
Orc4 G A 2: 48,937,489 P31S probably benign Het
Pard3 C T 8: 127,398,627 P421S probably benign Het
Pcdhb22 G T 18: 37,520,421 E647D probably benign Het
Pclo A G 5: 14,679,992 probably benign Het
Prkce G T 17: 86,490,750 probably null Het
Prr12 T C 7: 45,048,523 D656G unknown Het
Ptprk A T 10: 28,466,052 D485V probably damaging Het
Ptprn2 T C 12: 116,876,000 L381P probably damaging Het
Rnf144b T C 13: 47,207,537 I51T probably benign Het
Rpl10l T C 12: 66,283,738 D207G probably benign Het
Sh3glb2 A T 2: 30,350,699 V118E probably damaging Het
Sipa1l2 C T 8: 125,492,424 G58D probably damaging Het
Slc5a4a C T 10: 76,148,362 A46V probably damaging Het
Tepp T A 8: 95,313,010 Y18* probably null Het
Tgm7 C A 2: 121,098,588 probably null Het
Trpm6 A T 19: 18,796,500 I414F probably damaging Het
Tsr3 C G 17: 25,241,749 D196E probably benign Het
Ubqlnl C T 7: 104,149,718 V191M probably benign Het
Vmn2r72 T A 7: 85,751,926 H95L probably benign Het
Vmn2r97 T A 17: 18,929,071 N240K probably benign Het
Xdh C A 17: 73,898,344 G1042V probably damaging Het
Zcchc4 A G 5: 52,784,067 D68G probably damaging Het
Other mutations in Tjap1
AlleleSourceChrCoordTypePredicted EffectPPH Score
I0000:Tjap1 UTSW 17 46259029 missense probably damaging 1.00
PIT4519001:Tjap1 UTSW 17 46261506 missense probably benign 0.09
R0087:Tjap1 UTSW 17 46263726 missense probably damaging 1.00
R0930:Tjap1 UTSW 17 46258529 missense possibly damaging 0.94
R1513:Tjap1 UTSW 17 46261442 missense probably benign 0.01
R1885:Tjap1 UTSW 17 46262421 missense probably damaging 1.00
R2518:Tjap1 UTSW 17 46260095 missense probably damaging 1.00
R4552:Tjap1 UTSW 17 46260027 splice site probably null
R5452:Tjap1 UTSW 17 46260175 missense probably damaging 0.99
R5590:Tjap1 UTSW 17 46258871 missense probably damaging 1.00
R6600:Tjap1 UTSW 17 46259998 missense probably damaging 1.00
R7015:Tjap1 UTSW 17 46263774 missense possibly damaging 0.87
R7790:Tjap1 UTSW 17 46258690 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- AGGCAGGTTCAGCATTTCC -3'
(R):5'- AACTGTACCTATGCCACCCG -3'

Sequencing Primer
(F):5'- GGCAGGTTCAGCATTTCCTCTTC -3'
(R):5'- CATCTCCTTGAGCCTGGTGGAG -3'
Posted On2015-08-18