Incidental Mutation 'R0218:Mcc'
ID33691
Institutional Source Beutler Lab
Gene Symbol Mcc
Ensembl Gene ENSMUSG00000071856
Gene Namemutated in colorectal cancers
SynonymsD18Ertd451e
MMRRC Submission 038467-MU
Accession Numbers

Ncbi RefSeq: NM_001085373.1, NM_001085374.1; MGI:96930

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0218 (G1)
Quality Score225
Status Not validated
Chromosome18
Chromosomal Location44425060-44812182 bp(-) (GRCm38)
Type of Mutationcritical splice donor site
DNA Base Change (assembly) C to G at 44519516 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000128032 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000089874] [ENSMUST00000089874] [ENSMUST00000164666] [ENSMUST00000164666]
Predicted Effect probably benign
Transcript: ENSMUST00000089874
SMART Domains Protein: ENSMUSP00000087318
Gene: ENSMUSG00000071856

DomainStartEndE-ValueType
low complexity region 9 23 N/A INTRINSIC
EFh 24 52 1.36e-3 SMART
EFh 57 85 7.36e0 SMART
coiled coil region 196 308 N/A INTRINSIC
coiled coil region 395 466 N/A INTRINSIC
low complexity region 488 493 N/A INTRINSIC
low complexity region 512 517 N/A INTRINSIC
low complexity region 523 537 N/A INTRINSIC
Pfam:MCC-bdg_PDZ 577 641 2.6e-32 PFAM
low complexity region 715 731 N/A INTRINSIC
coiled coil region 738 834 N/A INTRINSIC
low complexity region 853 863 N/A INTRINSIC
Pfam:MCC-bdg_PDZ 906 972 1.1e-21 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000089874
SMART Domains Protein: ENSMUSP00000087318
Gene: ENSMUSG00000071856

DomainStartEndE-ValueType
low complexity region 9 23 N/A INTRINSIC
EFh 24 52 1.36e-3 SMART
EFh 57 85 7.36e0 SMART
coiled coil region 196 308 N/A INTRINSIC
coiled coil region 395 466 N/A INTRINSIC
low complexity region 488 493 N/A INTRINSIC
low complexity region 512 517 N/A INTRINSIC
low complexity region 523 537 N/A INTRINSIC
Pfam:MCC-bdg_PDZ 577 641 2.6e-32 PFAM
low complexity region 715 731 N/A INTRINSIC
coiled coil region 738 834 N/A INTRINSIC
low complexity region 853 863 N/A INTRINSIC
Pfam:MCC-bdg_PDZ 906 972 1.1e-21 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000164666
SMART Domains Protein: ENSMUSP00000128032
Gene: ENSMUSG00000071856

DomainStartEndE-ValueType
coiled coil region 21 133 N/A INTRINSIC
Pfam:MCC-bdg_PDZ 233 289 1.2e-14 PFAM
low complexity region 313 318 N/A INTRINSIC
low complexity region 337 342 N/A INTRINSIC
low complexity region 348 362 N/A INTRINSIC
Pfam:MCC-bdg_PDZ 401 467 3.8e-32 PFAM
low complexity region 540 556 N/A INTRINSIC
coiled coil region 563 659 N/A INTRINSIC
low complexity region 678 688 N/A INTRINSIC
Pfam:MCC-bdg_PDZ 730 798 1.3e-27 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000164666
SMART Domains Protein: ENSMUSP00000128032
Gene: ENSMUSG00000071856

DomainStartEndE-ValueType
coiled coil region 21 133 N/A INTRINSIC
Pfam:MCC-bdg_PDZ 233 289 1.2e-14 PFAM
low complexity region 313 318 N/A INTRINSIC
low complexity region 337 342 N/A INTRINSIC
low complexity region 348 362 N/A INTRINSIC
Pfam:MCC-bdg_PDZ 401 467 3.8e-32 PFAM
low complexity region 540 556 N/A INTRINSIC
coiled coil region 563 659 N/A INTRINSIC
low complexity region 678 688 N/A INTRINSIC
Pfam:MCC-bdg_PDZ 730 798 1.3e-27 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000202090
Meta Mutation Damage Score 0.1325 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.2%
  • 10x: 96.0%
  • 20x: 91.7%
Validation Efficiency 98% (53/54)
MGI Phenotype Strain: 3889488; 4335844
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a candidate colorectal tumor suppressor gene that is thought to negatively regulate cell cycle progression. The orthologous gene in the mouse expresses a phosphoprotein associated with the plasma membrane and membrane organelles, and overexpression of the mouse protein inhibits entry into S phase. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for hypomorphic or null mutations are viable and fertile with no gross abnormalities. [provided by MGI curators]
Allele List at MGI

All alleles(29) : Targeted(2) Gene trapped(27)

Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700017D01Rik A T 19: 11,116,437 Y10* probably null Het
Adgrv1 C T 13: 81,106,898 probably null Het
Ccdc110 A G 8: 45,934,724 probably benign Het
Cd200r1 T A 16: 44,788,743 probably benign Het
Cdkl1 A T 12: 69,790,035 D40E probably benign Het
Cdx1 A G 18: 61,020,364 probably benign Het
Cenpp T A 13: 49,647,632 K103N possibly damaging Het
Cep162 A G 9: 87,211,809 Y839H possibly damaging Het
Chac1 T A 2: 119,353,460 L181* probably null Het
Ciapin1 G T 8: 94,828,310 Q173K probably damaging Het
Dgcr2 A G 16: 17,849,786 C270R probably damaging Het
Dlc1 A G 8: 36,850,229 S431P probably benign Het
Efcab12 T C 6: 115,814,650 probably benign Het
Ehbp1 A T 11: 22,231,992 probably benign Het
Enpp3 A T 10: 24,776,869 V730D possibly damaging Het
Fam174b A G 7: 73,740,764 T88A probably benign Het
Fancl A G 11: 26,471,337 K364E probably benign Het
Fbp2 A T 13: 62,854,048 F118I probably damaging Het
Galc A G 12: 98,222,647 Y402H probably damaging Het
Gga2 T C 7: 121,998,900 N324D possibly damaging Het
Gm13103 A G 4: 143,851,831 I220M probably damaging Het
Gm5346 T G 8: 43,626,440 Q249P probably benign Het
Gpr1 T A 1: 63,183,531 N182Y probably benign Het
Hc G T 2: 35,028,074 F732L probably damaging Het
Heca T C 10: 17,915,715 M198V probably benign Het
Herc6 C A 6: 57,619,601 H509N probably benign Het
Irf2bpl A T 12: 86,882,624 M425K probably benign Het
Mael C T 1: 166,238,590 G26D probably damaging Het
Map1a A G 2: 121,305,425 T2241A probably benign Het
Mdga2 A G 12: 66,655,120 S505P probably damaging Het
Mdm1 A G 10: 118,156,878 probably benign Het
Mex3b A T 7: 82,869,104 E209V probably damaging Het
Mrgprx3-ps T C 7: 47,309,406 E279G possibly damaging Het
Nfe2l1 A T 11: 96,827,613 L32Q probably damaging Het
Npas1 C T 7: 16,461,893 V285I probably benign Het
Olfr1499 T C 19: 13,814,978 N204S probably benign Het
Olfr187 C T 16: 59,036,093 V215I probably benign Het
Olfr513 T A 7: 108,755,574 C239* probably null Het
Osr1 A G 12: 9,579,639 T171A probably benign Het
Ppp3cb A T 14: 20,523,976 C265S probably damaging Het
Sephs1 A G 2: 4,899,560 T250A probably benign Het
Simc1 T C 13: 54,526,604 Y922H probably damaging Het
Slc25a39 A G 11: 102,406,230 F56L probably benign Het
Smg8 A G 11: 87,086,122 L211P probably damaging Het
Sncaip A G 18: 52,907,328 S805G probably benign Het
Sra1 T C 18: 36,676,609 probably benign Het
Tas2r104 T G 6: 131,685,092 D218A probably damaging Het
Unc45b A G 11: 82,911,860 probably benign Het
Unc79 A G 12: 103,108,781 probably null Het
Washc2 T A 6: 116,248,046 L785* probably null Het
Zfp30 A G 7: 29,793,638 E439G probably damaging Het
Zfp518a A G 19: 40,912,628 T334A probably benign Het
Other mutations in Mcc
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00489:Mcc APN 18 44449216 missense possibly damaging 0.93
IGL00981:Mcc APN 18 44449349 missense probably damaging 0.99
IGL00985:Mcc APN 18 44491239 missense probably damaging 1.00
IGL01674:Mcc APN 18 44491156 missense probably benign 0.10
IGL01862:Mcc APN 18 44759296 missense probably benign 0.00
IGL01935:Mcc APN 18 44519516 critical splice donor site probably null
IGL02168:Mcc APN 18 44449299 missense probably damaging 0.97
IGL02449:Mcc APN 18 44459958 missense probably benign 0.10
IGL02613:Mcc APN 18 44429954 missense probably damaging 1.00
IGL02709:Mcc APN 18 44445810 missense possibly damaging 0.73
R0009:Mcc UTSW 18 44445933 missense probably damaging 1.00
R0009:Mcc UTSW 18 44445933 missense probably damaging 1.00
R0021:Mcc UTSW 18 44519516 critical splice donor site probably benign
R0022:Mcc UTSW 18 44519516 critical splice donor site probably benign
R0062:Mcc UTSW 18 44519516 critical splice donor site probably benign
R0062:Mcc UTSW 18 44519516 critical splice donor site probably benign
R0063:Mcc UTSW 18 44519516 critical splice donor site probably benign
R0064:Mcc UTSW 18 44519516 critical splice donor site probably benign
R0217:Mcc UTSW 18 44519516 critical splice donor site probably benign
R0243:Mcc UTSW 18 44759299 missense probably benign
R0373:Mcc UTSW 18 44475222 missense probably benign 0.01
R0564:Mcc UTSW 18 44468507 missense probably damaging 1.00
R0604:Mcc UTSW 18 44473756 missense probably damaging 1.00
R0691:Mcc UTSW 18 44445860 missense possibly damaging 0.67
R0965:Mcc UTSW 18 44724526 missense probably benign 0.41
R1015:Mcc UTSW 18 44724669 missense probably benign
R1186:Mcc UTSW 18 44759403 missense probably benign
R1215:Mcc UTSW 18 44468494 missense possibly damaging 0.93
R1878:Mcc UTSW 18 44468400 missense possibly damaging 0.69
R1990:Mcc UTSW 18 44491315 nonsense probably null
R1991:Mcc UTSW 18 44491315 nonsense probably null
R1992:Mcc UTSW 18 44491315 nonsense probably null
R2186:Mcc UTSW 18 44812078 missense possibly damaging 0.71
R2189:Mcc UTSW 18 44534230 missense possibly damaging 0.93
R2258:Mcc UTSW 18 44475136 missense probably damaging 1.00
R2267:Mcc UTSW 18 44519541 missense probably damaging 0.99
R2310:Mcc UTSW 18 44431366 missense probably damaging 1.00
R2343:Mcc UTSW 18 44459797 critical splice donor site probably null
R2377:Mcc UTSW 18 44519549 missense probably damaging 1.00
R3110:Mcc UTSW 18 44449263 missense probably damaging 1.00
R3112:Mcc UTSW 18 44449263 missense probably damaging 1.00
R4135:Mcc UTSW 18 44724640 missense probably benign 0.03
R4404:Mcc UTSW 18 44759298 missense probably benign
R4600:Mcc UTSW 18 44519520 missense probably damaging 1.00
R4606:Mcc UTSW 18 44468421 missense probably damaging 0.96
R4721:Mcc UTSW 18 44519556 missense probably damaging 1.00
R5858:Mcc UTSW 18 44510141 missense probably damaging 0.98
R5997:Mcc UTSW 18 44449321 missense probably damaging 1.00
R6482:Mcc UTSW 18 44445864 missense possibly damaging 0.94
R6502:Mcc UTSW 18 44468390 nonsense probably null
R6502:Mcc UTSW 18 44468391 missense probably damaging 1.00
R6518:Mcc UTSW 18 44661811 start gained probably benign
R6796:Mcc UTSW 18 44724560 missense probably benign
R6846:Mcc UTSW 18 44473640 missense possibly damaging 0.63
R6879:Mcc UTSW 18 44812112 missense unknown
R7147:Mcc UTSW 18 44493513 missense probably damaging 0.99
R7475:Mcc UTSW 18 44476236 missense probably damaging 0.98
R7515:Mcc UTSW 18 44493432 missense probably benign 0.02
R7608:Mcc UTSW 18 44491227 missense possibly damaging 0.83
X0010:Mcc UTSW 18 44429957 missense possibly damaging 0.94
Z1177:Mcc UTSW 18 44491246 missense probably benign 0.04
Predicted Primers PCR Primer
(F):5'- AAAGGCATCAGACTGTTGTCTGTCTC -3'
(R):5'- ACATAACCACATGTCCATCTTGTGCTC -3'

Sequencing Primer
(F):5'- GGGCATTCGCCTAGAACTTG -3'
(R):5'- GTCCATCTTGTGCTCTGTGTTC -3'
Posted On2013-05-09