Incidental Mutation 'R4646:Apob'
ID350273
Institutional Source Beutler Lab
Gene Symbol Apob
Ensembl Gene ENSMUSG00000020609
Gene Nameapolipoprotein B
Synonymsapob-100, apob-48
MMRRC Submission 041907-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.902) question?
Stock #R4646 (G1)
Quality Score225
Status Not validated
Chromosome12
Chromosomal Location7977648-8016835 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 8012759 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 134 (N134S)
Ref Sequence ENSEMBL: ENSMUSP00000129496 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000037520] [ENSMUST00000037811] [ENSMUST00000171239]
Predicted Effect probably benign
Transcript: ENSMUST00000037520
AA Change: N3714S

PolyPhen 2 Score 0.050 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000035761
Gene: ENSMUSG00000020609
AA Change: N3714S

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
LPD_N 33 585 6.03e-94 SMART
DUF1943 619 932 7.88e-97 SMART
Pfam:DUF1081 945 1059 9.4e-32 PFAM
low complexity region 1100 1109 N/A INTRINSIC
Blast:LPD_N 1249 1311 9e-22 BLAST
low complexity region 1632 1644 N/A INTRINSIC
internal_repeat_1 1882 2038 6.61e-9 PROSPERO
SCOP:d1gw5a_ 2105 2577 9e-5 SMART
internal_repeat_1 2973 3150 6.61e-9 PROSPERO
low complexity region 3561 3580 N/A INTRINSIC
low complexity region 3928 3936 N/A INTRINSIC
Pfam:ApoB100_C 4401 4456 5.6e-34 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000037811
AA Change: N3747S

PolyPhen 2 Score 0.108 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000036044
Gene: ENSMUSG00000020609
AA Change: N3747S

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
LPD_N 46 598 6.03e-94 SMART
DUF1943 632 945 7.88e-97 SMART
Pfam:DUF1081 960 1070 6.3e-39 PFAM
low complexity region 1113 1122 N/A INTRINSIC
Blast:LPD_N 1282 1344 1e-21 BLAST
low complexity region 1665 1677 N/A INTRINSIC
internal_repeat_1 1915 2071 6.6e-9 PROSPERO
SCOP:d1gw5a_ 2138 2610 9e-5 SMART
internal_repeat_1 3006 3183 6.6e-9 PROSPERO
low complexity region 3594 3613 N/A INTRINSIC
low complexity region 3961 3969 N/A INTRINSIC
Pfam:ApoB100_C 4434 4490 1.6e-32 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000171239
AA Change: N134S

PolyPhen 2 Score 0.207 (Sensitivity: 0.92; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000129496
Gene: ENSMUSG00000020609
AA Change: N134S

DomainStartEndE-ValueType
low complexity region 348 356 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.6%
Validation Efficiency
MGI Phenotype FUNCTION: This gene product is the main apolipoprotein of chylomicrons and low density lipoproteins. It occurs in plasma as two main isoforms, apoB-48 and apoB-100. Unlike the apoB-48 and apoB-100 structural equivalents in human, which are synthesized exclusively in the gut and liver, respectively, the mouse apoB-48 isoform is also found in mouse liver. The intestinal and the hepatic forms of apoB are encoded by a single gene from a single, very long mRNA. The two isoforms share a common N-terminal sequence. The shorter apoB-48 protein is produced after RNA editing of the apoB-100 transcript at residue 2179 (CAA->UAA), resulting in the creation of a stop codon, and early translation termination. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mutants usually die by midgestation and longer survivors exhibit exencephaly. Heterozygotes show reduced plasma cholesterol and apolipoprotein levels. Single isoform B100 and B48 null mutants are viable. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 102 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700031F05Rik G T X: 102,860,909 N132K possibly damaging Het
2010315B03Rik T A 9: 124,293,598 Y232F probably benign Het
Acadl A T 1: 66,831,443 S428R probably benign Het
Adamts10 A G 17: 33,545,555 D683G probably damaging Het
Angptl4 G A 17: 33,781,299 P32S probably benign Het
Atr G A 9: 95,871,197 probably null Het
B4galnt1 G A 10: 127,167,836 V223M probably damaging Het
Bbs10 A G 10: 111,301,134 K703E probably benign Het
C1galt1c1 A T X: 38,631,472 S216T probably benign Het
C2cd3 A C 7: 100,372,450 probably benign Het
Clca4b A C 3: 144,928,525 H102Q probably benign Het
Cntrl T C 2: 35,149,461 I557T probably damaging Het
Col26a1 G A 5: 136,847,550 S72F probably damaging Het
Crocc2 G A 1: 93,168,794 V24M possibly damaging Het
Csmd1 T C 8: 15,932,511 I2719V possibly damaging Het
Cul9 C T 17: 46,539,017 W502* probably null Het
Dazl A T 17: 50,288,155 F84I probably damaging Het
Dcaf1 G T 9: 106,846,807 R478L probably benign Het
Dock5 T G 14: 67,842,779 I198L probably benign Het
Dock9 A T 14: 121,586,246 L1428H probably damaging Het
Dync1li1 T A 9: 114,709,169 V198E probably damaging Het
E130309D02Rik A T 5: 143,307,985 W246R probably damaging Het
Egf A T 3: 129,720,276 C429S probably damaging Het
Ehmt1 T C 2: 24,891,684 E7G probably null Het
Ercc4 G T 16: 13,147,574 R690L probably damaging Het
Erich5 T C 15: 34,470,966 C114R possibly damaging Het
Etv1 T C 12: 38,865,686 S428P possibly damaging Het
Fam19a5 T G 15: 87,720,582 S115A probably damaging Het
Fbxo31 G T 8: 121,560,016 F174L probably benign Het
Fbxo33 T A 12: 59,204,431 I433L probably benign Het
Fez2 A T 17: 78,412,928 V99E probably damaging Het
Gabarapl2 A C 8: 111,942,553 K48Q probably damaging Het
Gfi1b T A 2: 28,610,137 H294L probably damaging Het
Gk2 A G 5: 97,456,197 S261P probably damaging Het
Gm7534 G A 4: 134,202,148 A282V probably benign Het
Gpr158 T C 2: 21,827,053 I988T probably benign Het
Grk3 G C 5: 112,929,720 H394D probably benign Het
Grm6 A G 11: 50,857,206 E381G probably benign Het
Gtf3c1 A T 7: 125,659,094 M1268K possibly damaging Het
Hikeshi A T 7: 89,923,646 I113N probably damaging Het
Hmg20b T A 10: 81,348,582 Q129L probably damaging Het
Hunk C A 16: 90,475,903 T365K probably damaging Het
Kdm5a T G 6: 120,374,977 V176G possibly damaging Het
Kif2a T A 13: 106,962,185 E691V probably damaging Het
Ly6e T C 15: 74,958,661 probably null Het
Map1b G T 13: 99,432,469 P1248Q unknown Het
Mettl25 A G 10: 105,826,555 S185P probably damaging Het
Mfap3l T A 8: 60,671,150 V142D probably damaging Het
Mip T A 10: 128,227,053 H122Q probably benign Het
Mkx G A 18: 6,992,040 T280I probably benign Het
Msi1 A T 5: 115,451,455 probably null Het
Muc5b A G 7: 141,862,640 M3108V probably benign Het
Mybl1 A G 1: 9,672,286 S625P probably damaging Het
Myo7b C A 18: 31,994,369 V627F probably benign Het
Ndst3 A T 3: 123,672,035 I96N probably damaging Het
Nrp1 A T 8: 128,457,944 T357S probably benign Het
Obscn G T 11: 59,124,570 Y1050* probably null Het
Olfr1212 T A 2: 88,959,212 F249I probably damaging Het
Olfr1386 A C 11: 49,470,624 I158L probably benign Het
Olfr152 T C 2: 87,783,221 V227A possibly damaging Het
Olfr320 A G 11: 58,684,730 N286D probably damaging Het
Olfr710 A T 7: 106,944,340 N220K probably benign Het
Olfr74 A T 2: 87,973,798 I289K probably benign Het
Otof T C 5: 30,383,570 E875G possibly damaging Het
Pick1 A T 15: 79,248,937 D399V probably benign Het
Pik3c2g T A 6: 139,720,018 S22T probably benign Het
Pnpla2 A G 7: 141,458,661 E276G possibly damaging Het
Pomk A T 8: 25,983,605 S107T probably damaging Het
Rbm46 A T 3: 82,864,458 D283E probably benign Het
Rimbp3 A G 16: 17,213,098 D1462G probably damaging Het
Rnf112 T A 11: 61,452,110 E230V probably damaging Het
Rock1 T C 18: 10,112,391 T455A probably benign Het
Rtp4 A T 16: 23,610,040 M18L probably benign Het
Scaf11 A T 15: 96,420,100 probably null Het
Schip1 T C 3: 68,064,964 V8A probably benign Het
Sec31b T C 19: 44,526,621 H351R probably benign Het
Sh3bp5l A G 11: 58,346,351 D378G probably benign Het
Soga1 T C 2: 157,020,506 E1501G probably damaging Het
Sowahb T C 5: 93,042,856 D668G probably damaging Het
Spam1 A G 6: 24,800,587 T442A probably benign Het
Syt14 T A 1: 192,933,325 Y451F probably damaging Het
Tdh A G 14: 63,493,756 L323P possibly damaging Het
Tet2 A T 3: 133,488,082 M197K probably benign Het
Thbs1 G A 2: 118,118,329 A489T probably benign Het
Tnfaip1 C T 11: 78,529,182 R88Q probably damaging Het
Tnn T C 1: 160,146,042 M252V probably benign Het
Trdn G T 10: 33,195,981 E215* probably null Het
Trim55 T C 3: 19,671,122 F268L probably benign Het
Trmt112 T A 19: 6,910,448 V55E possibly damaging Het
Tube1 A G 10: 39,142,367 M147V possibly damaging Het
Ubn1 A G 16: 5,077,987 T966A probably damaging Het
Unc80 A G 1: 66,669,235 I2651V probably benign Het
Vmn1r172 G A 7: 23,660,494 R268H probably benign Het
Vmn1r231 T A 17: 20,890,309 I115F probably damaging Het
Vmn1r237 A G 17: 21,314,138 K41R probably benign Het
Vmn2r58 A T 7: 41,860,511 N547K probably damaging Het
Vmn2r74 T C 7: 85,957,574 D188G probably benign Het
Vwa5b2 A G 16: 20,596,329 K367R probably damaging Het
Washc4 T A 10: 83,574,543 M665K possibly damaging Het
Wbp11 T A 6: 136,821,191 Y236F probably benign Het
Wbp4 T A 14: 79,472,361 I145F possibly damaging Het
Wwc2 C A 8: 47,920,601 D77Y probably damaging Het
Other mutations in Apob
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00402:Apob APN 12 7993065 splice site probably benign
IGL00421:Apob APN 12 8010197 missense probably damaging 0.99
IGL00658:Apob APN 12 8009471 missense probably benign 0.08
IGL00768:Apob APN 12 8002107 missense probably damaging 1.00
IGL00833:Apob APN 12 8010101 missense probably benign 0.14
IGL00926:Apob APN 12 8015421 missense probably benign 0.01
IGL01065:Apob APN 12 8003299 missense probably damaging 0.99
IGL01313:Apob APN 12 8000898 missense probably damaging 1.00
IGL01419:Apob APN 12 8002251 missense probably damaging 0.99
IGL01461:Apob APN 12 8001884 missense probably benign 0.13
IGL02002:Apob APN 12 7994822 missense probably benign 0.03
IGL02031:Apob APN 12 8015222 missense probably benign
IGL02102:Apob APN 12 7989407 missense possibly damaging 0.94
IGL02115:Apob APN 12 7992923 missense probably benign 0.06
IGL02513:Apob APN 12 7992979 missense probably benign 0.01
IGL02967:Apob APN 12 8015366 nonsense probably null
IGL03005:Apob APN 12 7993059 splice site probably benign
IGL03011:Apob APN 12 7997883 missense probably damaging 1.00
IGL03116:Apob APN 12 8016350 missense probably damaging 0.98
IGL03215:Apob APN 12 8013818 missense possibly damaging 0.92
IGL03227:Apob APN 12 8016089 missense probably benign 0.04
Aesthete UTSW 12 8010080 nonsense probably null
Essence UTSW 12 8007769 nonsense probably null
Ethos UTSW 12 7990394 missense probably null 1.00
IGL02835:Apob UTSW 12 8015097 missense possibly damaging 0.86
IGL02837:Apob UTSW 12 8005102 missense probably damaging 1.00
R0071:Apob UTSW 12 8002111 missense probably damaging 0.98
R0071:Apob UTSW 12 8002111 missense probably damaging 0.98
R0116:Apob UTSW 12 7989113 unclassified probably benign
R0180:Apob UTSW 12 8008285 nonsense probably null
R0288:Apob UTSW 12 7990779 nonsense probably null
R0295:Apob UTSW 12 8002181 nonsense probably null
R0305:Apob UTSW 12 8012210 missense probably damaging 1.00
R0312:Apob UTSW 12 8009034 missense probably benign
R0324:Apob UTSW 12 8010521 missense probably benign 0.41
R0326:Apob UTSW 12 7990307 missense probably damaging 1.00
R0363:Apob UTSW 12 8010136 missense probably damaging 1.00
R0390:Apob UTSW 12 7988678 missense probably damaging 0.99
R0462:Apob UTSW 12 8000896 missense probably damaging 1.00
R0471:Apob UTSW 12 7990406 missense probably damaging 1.00
R0532:Apob UTSW 12 8016188 missense possibly damaging 0.48
R0548:Apob UTSW 12 8006282 missense probably damaging 1.00
R0560:Apob UTSW 12 8005101 missense probably damaging 1.00
R0595:Apob UTSW 12 8008369 missense probably benign 0.01
R0600:Apob UTSW 12 8006440 missense probably damaging 1.00
R0626:Apob UTSW 12 8016193 missense probably benign 0.45
R0685:Apob UTSW 12 8010742 missense probably benign
R0765:Apob UTSW 12 8016518 missense probably benign
R0790:Apob UTSW 12 8010245 missense probably damaging 1.00
R0918:Apob UTSW 12 7983941 missense probably benign 0.10
R0962:Apob UTSW 12 7989191 missense probably damaging 0.98
R1055:Apob UTSW 12 7994963 missense probably damaging 1.00
R1077:Apob UTSW 12 8006017 missense probably benign
R1143:Apob UTSW 12 8012354 missense probably benign 0.26
R1163:Apob UTSW 12 8011654 missense probably damaging 1.00
R1266:Apob UTSW 12 8006093 missense probably benign 0.37
R1434:Apob UTSW 12 8009715 missense probably damaging 1.00
R1442:Apob UTSW 12 7986165 missense probably benign 0.31
R1445:Apob UTSW 12 8016084 missense possibly damaging 0.48
R1459:Apob UTSW 12 8006047 missense probably benign
R1459:Apob UTSW 12 8011937 missense possibly damaging 0.92
R1465:Apob UTSW 12 8011421 missense possibly damaging 0.91
R1465:Apob UTSW 12 8011421 missense possibly damaging 0.91
R1508:Apob UTSW 12 8011481 missense possibly damaging 0.92
R1518:Apob UTSW 12 7989207 missense probably benign 0.01
R1531:Apob UTSW 12 7997880 missense possibly damaging 0.65
R1547:Apob UTSW 12 8003368 missense probably benign 0.08
R1574:Apob UTSW 12 7990839 missense possibly damaging 0.51
R1574:Apob UTSW 12 7990839 missense possibly damaging 0.51
R1682:Apob UTSW 12 8012365 missense probably benign 0.00
R1709:Apob UTSW 12 8009306 missense probably damaging 0.98
R1718:Apob UTSW 12 8016087 missense probably benign 0.02
R1752:Apob UTSW 12 7988766 missense probably benign 0.01
R1781:Apob UTSW 12 8009603 missense possibly damaging 0.96
R1818:Apob UTSW 12 8006834 missense probably damaging 0.98
R1818:Apob UTSW 12 8013064 missense possibly damaging 0.93
R1842:Apob UTSW 12 8011559 missense probably damaging 1.00
R1843:Apob UTSW 12 8007602 missense possibly damaging 0.65
R1853:Apob UTSW 12 8010928 nonsense probably null
R1990:Apob UTSW 12 8001039 missense probably damaging 1.00
R2016:Apob UTSW 12 8007751 missense possibly damaging 0.48
R2017:Apob UTSW 12 8007751 missense possibly damaging 0.48
R2023:Apob UTSW 12 8011090 missense probably benign 0.01
R2037:Apob UTSW 12 8007488 missense probably benign 0.37
R2054:Apob UTSW 12 8013134 missense probably damaging 1.00
R2057:Apob UTSW 12 8002164 nonsense probably null
R2085:Apob UTSW 12 8012240 missense probably damaging 1.00
R2159:Apob UTSW 12 8010081 missense probably benign 0.12
R2209:Apob UTSW 12 8007752 missense probably benign 0.28
R2249:Apob UTSW 12 8007499 missense probably damaging 1.00
R2254:Apob UTSW 12 8011256 missense possibly damaging 0.92
R2265:Apob UTSW 12 8015475 missense possibly damaging 0.74
R2266:Apob UTSW 12 8015475 missense possibly damaging 0.74
R2267:Apob UTSW 12 8015475 missense possibly damaging 0.74
R2268:Apob UTSW 12 8015475 missense possibly damaging 0.74
R2296:Apob UTSW 12 7994879 missense probably damaging 0.97
R2897:Apob UTSW 12 8010356 missense probably damaging 1.00
R3431:Apob UTSW 12 8010778 missense probably damaging 1.00
R3723:Apob UTSW 12 8006327 missense probably damaging 1.00
R3723:Apob UTSW 12 8011763 missense possibly damaging 0.46
R3899:Apob UTSW 12 8015849 missense possibly damaging 0.87
R4020:Apob UTSW 12 7994914 nonsense probably null
R4050:Apob UTSW 12 8015390 missense probably benign 0.02
R4351:Apob UTSW 12 7993054 missense probably benign 0.03
R4365:Apob UTSW 12 8016083 missense possibly damaging 0.95
R4366:Apob UTSW 12 8016083 missense possibly damaging 0.95
R4456:Apob UTSW 12 8015445 missense probably damaging 1.00
R4458:Apob UTSW 12 8015445 missense probably damaging 1.00
R4600:Apob UTSW 12 8008568 missense probably damaging 1.00
R4611:Apob UTSW 12 8011331 missense probably damaging 1.00
R4678:Apob UTSW 12 7995585 missense probably damaging 1.00
R4685:Apob UTSW 12 8006456 missense probably benign 0.00
R4707:Apob UTSW 12 8006205 missense probably damaging 0.96
R4726:Apob UTSW 12 7990267 missense probably damaging 0.98
R4792:Apob UTSW 12 8008051 missense probably benign 0.26
R4822:Apob UTSW 12 8015741 missense probably benign 0.04
R4834:Apob UTSW 12 8014101 missense possibly damaging 0.49
R4835:Apob UTSW 12 8015391 missense possibly damaging 0.56
R4887:Apob UTSW 12 8013099 missense probably damaging 1.00
R4910:Apob UTSW 12 8007848 missense probably damaging 1.00
R5072:Apob UTSW 12 8008714 missense probably benign 0.00
R5073:Apob UTSW 12 8005219 critical splice donor site probably null
R5074:Apob UTSW 12 8005219 critical splice donor site probably null
R5101:Apob UTSW 12 8011934 missense probably benign 0.09
R5123:Apob UTSW 12 8007630 splice site probably null
R5133:Apob UTSW 12 8008898 missense probably damaging 0.99
R5135:Apob UTSW 12 8010086 missense probably damaging 1.00
R5137:Apob UTSW 12 8011384 missense possibly damaging 0.63
R5160:Apob UTSW 12 8012126 missense possibly damaging 0.90
R5173:Apob UTSW 12 8008238 missense probably benign 0.00
R5202:Apob UTSW 12 8013737 missense probably damaging 0.98
R5229:Apob UTSW 12 7977806 missense probably benign
R5292:Apob UTSW 12 8005912 missense probably benign 0.01
R5378:Apob UTSW 12 8011865 missense probably damaging 0.99
R5494:Apob UTSW 12 8011762 missense probably damaging 0.99
R5517:Apob UTSW 12 7990906 missense probably damaging 1.00
R5576:Apob UTSW 12 7998662 missense probably damaging 1.00
R5582:Apob UTSW 12 8010788 missense probably damaging 1.00
R5629:Apob UTSW 12 8007847 missense probably damaging 1.00
R5678:Apob UTSW 12 7991494 missense possibly damaging 0.92
R5732:Apob UTSW 12 8010353 missense probably benign 0.15
R5734:Apob UTSW 12 7988781 missense probably damaging 1.00
R5742:Apob UTSW 12 8007191 missense probably damaging 1.00
R5751:Apob UTSW 12 8012619 nonsense probably null
R5776:Apob UTSW 12 8006149 missense possibly damaging 0.57
R5778:Apob UTSW 12 8015074 missense probably benign 0.45
R5783:Apob UTSW 12 8001022 missense probably damaging 1.00
R5786:Apob UTSW 12 8015304 missense possibly damaging 0.48
R5837:Apob UTSW 12 8003277 missense probably benign 0.04
R5857:Apob UTSW 12 8015397 missense probably benign 0.00
R6029:Apob UTSW 12 8016243 missense probably damaging 0.99
R6032:Apob UTSW 12 7995513 missense probably benign 0.02
R6032:Apob UTSW 12 7995513 missense probably benign 0.02
R6086:Apob UTSW 12 8015164 missense probably benign
R6110:Apob UTSW 12 8011883 missense probably damaging 1.00
R6131:Apob UTSW 12 8015874 missense probably benign 0.17
R6157:Apob UTSW 12 8006077 missense probably benign
R6179:Apob UTSW 12 8005060 nonsense probably null
R6247:Apob UTSW 12 8001801 missense probably damaging 1.00
R6279:Apob UTSW 12 8007769 nonsense probably null
R6300:Apob UTSW 12 8007769 nonsense probably null
R6320:Apob UTSW 12 7989194 missense probably benign 0.27
R6339:Apob UTSW 12 8016188 missense probably damaging 0.99
R6353:Apob UTSW 12 8009421 missense probably damaging 1.00
R6395:Apob UTSW 12 8008507 missense probably benign 0.45
R6441:Apob UTSW 12 7987796 missense probably damaging 1.00
R6492:Apob UTSW 12 8008261 missense probably damaging 0.99
R6495:Apob UTSW 12 7990394 missense probably null 1.00
R6502:Apob UTSW 12 8001814 missense probably damaging 0.99
R6520:Apob UTSW 12 7983124 missense probably damaging 1.00
R6644:Apob UTSW 12 8009077 missense probably damaging 0.97
R6704:Apob UTSW 12 8010379 missense probably damaging 0.98
R6750:Apob UTSW 12 7997853 missense probably damaging 1.00
R6759:Apob UTSW 12 8011049 missense probably benign 0.06
R6812:Apob UTSW 12 7983062 missense probably damaging 0.98
R6865:Apob UTSW 12 8008847 missense probably benign 0.05
R6873:Apob UTSW 12 8015995 missense probably benign 0.00
R7013:Apob UTSW 12 8010080 nonsense probably null
R7067:Apob UTSW 12 8009423 missense probably damaging 1.00
R7084:Apob UTSW 12 8009591 missense probably benign
R7113:Apob UTSW 12 7995539 missense probably damaging 1.00
R7175:Apob UTSW 12 8007034 missense probably benign 0.33
R7196:Apob UTSW 12 7983893 missense possibly damaging 0.90
R7199:Apob UTSW 12 8005072 missense probably damaging 1.00
R7205:Apob UTSW 12 8005087 missense probably damaging 0.98
R7251:Apob UTSW 12 8007037 missense probably damaging 0.98
R7474:Apob UTSW 12 8009185 missense probably benign 0.29
R7484:Apob UTSW 12 8006884 nonsense probably null
R7538:Apob UTSW 12 8002219 missense probably damaging 0.98
R7636:Apob UTSW 12 8009516 missense possibly damaging 0.86
R7646:Apob UTSW 12 8009189 missense probably damaging 0.99
R7787:Apob UTSW 12 7990780 missense probably damaging 0.97
R7793:Apob UTSW 12 8008124 missense probably damaging 0.99
R7836:Apob UTSW 12 8001885 missense possibly damaging 0.72
R7895:Apob UTSW 12 8011933 missense probably benign 0.00
R8005:Apob UTSW 12 8009744 missense probably benign 0.01
R8013:Apob UTSW 12 8010798 missense possibly damaging 0.94
R8014:Apob UTSW 12 8010798 missense possibly damaging 0.94
R8111:Apob UTSW 12 8008801 missense probably benign 0.16
R8117:Apob UTSW 12 8006435 missense probably damaging 0.99
R8226:Apob UTSW 12 8009056 missense probably benign 0.00
R8244:Apob UTSW 12 8010548 missense probably damaging 0.96
R8280:Apob UTSW 12 8010851 missense possibly damaging 0.46
R8310:Apob UTSW 12 8009033 missense probably benign 0.00
R8327:Apob UTSW 12 8001015 missense possibly damaging 0.72
R8329:Apob UTSW 12 8011135 missense probably damaging 0.98
R8331:Apob UTSW 12 8001882 missense probably benign 0.28
R8351:Apob UTSW 12 8006356
R8412:Apob UTSW 12 8008069 missense probably benign 0.33
R8425:Apob UTSW 12 7988842 missense possibly damaging 0.70
R8493:Apob UTSW 12 8009009
R8529:Apob UTSW 12 8007353
R8554:Apob UTSW 12 7987830
X0027:Apob UTSW 12 8007975 missense probably benign
Z1088:Apob UTSW 12 8005074 missense possibly damaging 0.91
Z1088:Apob UTSW 12 8005945 nonsense probably null
Z1088:Apob UTSW 12 8012936 missense possibly damaging 0.95
Z1176:Apob UTSW 12 7998011 missense probably damaging 1.00
Z1176:Apob UTSW 12 8004978 missense probably benign 0.00
Z1177:Apob UTSW 12 7988765 missense probably benign 0.43
Z1177:Apob UTSW 12 8015249 frame shift probably null
Predicted Primers PCR Primer
(F):5'- CAAGAGCTTGCAGGAACTCC -3'
(R):5'- TGGCCAACTTATTCAGATCAAAGAC -3'

Sequencing Primer
(F):5'- GGAAAGCGACAGTATCTTCAAGCTTC -3'
(R):5'- TCAAAGACTGTGTTGCCAACTGG -3'
Posted On2015-10-08