Mutagenetix > Incidental Mutation

Incidental Mutation 'R4646:Map1b'

350277

Institutional Source

Beutler Lab

Gene Symbol

Map1b

Ensembl Gene

ENSMUSG00000052727

Gene Name

microtubule-associated protein 1B

Synonyms

Mtap1b, MAP5, Mtap-5, Mtap5, LC1

MMRRC Submission

041907-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R4646 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

99421446-99516540 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to T at 99432469 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Proline to Glutamine at position 1248 (P1248Q)

Ref Sequence

ENSEMBL: ENSMUSP00000068374 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000064762]

AlphaFold

P14873

Predicted Effect

unknown
Transcript: ENSMUST00000064762
AA Change: P1248Q

SMART Domains

Protein: ENSMUSP00000068374
Gene: ENSMUSG00000052727
AA Change: P1248Q

Domain	Start	End	E-Value	Type
low complexity region	41	50	N/A	INTRINSIC
Blast:Lactamase_B	270	514	1e-56	BLAST
low complexity region	578	595	N/A	INTRINSIC
low complexity region	597	617	N/A	INTRINSIC
SCOP:d1gkub2	633	735	8e-4	SMART
low complexity region	771	813	N/A	INTRINSIC
low complexity region	855	866	N/A	INTRINSIC
low complexity region	889	913	N/A	INTRINSIC
low complexity region	935	956	N/A	INTRINSIC
low complexity region	1006	1030	N/A	INTRINSIC
low complexity region	1247	1261	N/A	INTRINSIC
low complexity region	1390	1404	N/A	INTRINSIC
low complexity region	1545	1557	N/A	INTRINSIC
low complexity region	1724	1735	N/A	INTRINSIC
Pfam:MAP1B_neuraxin	1891	1907	1.9e-10	PFAM
Pfam:MAP1B_neuraxin	1908	1924	8.3e-11	PFAM
Pfam:MAP1B_neuraxin	1942	1958	3.1e-9	PFAM
Pfam:MAP1B_neuraxin	1959	1975	6.2e-9	PFAM
Pfam:MAP1B_neuraxin	2027	2043	2.9e-10	PFAM
Pfam:MAP1B_neuraxin	2044	2060	3.9e-9	PFAM
low complexity region	2227	2257	N/A	INTRINSIC
low complexity region	2286	2307	N/A	INTRINSIC
low complexity region	2316	2343	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000223693

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000224702

Coding Region Coverage

1x: 99.0%
3x: 98.6%
10x: 97.4%
20x: 95.6%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that belongs to the microtubule-associated protein family. The proteins of this family are thought to be involved in microtubule assembly, which is an essential step in neurogenesis. The product of this gene is a precursor polypeptide that presumably undergoes proteolytic processing to generate the final MAP1B heavy chain and LC1 light chain. Gene knockout studies of the mouse microtubule-associated protein 1B gene suggested an important role in development and function of the nervous system. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for one knock-out allele die prior to E8.5. While mice homozygous for other knock-out alleles exhibit behavioral, visual system, and nervous system defects. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 102 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700031F05Rik	G	T	X: 102,860,909	N132K	possibly damaging	Het
2010315B03Rik	T	A	9: 124,293,598	Y232F	probably benign	Het
Acadl	A	T	1: 66,831,443	S428R	probably benign	Het
Adamts10	A	G	17: 33,545,555	D683G	probably damaging	Het
Angptl4	G	A	17: 33,781,299	P32S	probably benign	Het
Apob	A	G	12: 8,012,759	N134S	probably benign	Het
Atr	G	A	9: 95,871,197		probably null	Het
B4galnt1	G	A	10: 127,167,836	V223M	probably damaging	Het
Bbs10	A	G	10: 111,301,134	K703E	probably benign	Het
C1galt1c1	A	T	X: 38,631,472	S216T	probably benign	Het
C2cd3	A	C	7: 100,372,450		probably benign	Het
Clca4b	A	C	3: 144,928,525	H102Q	probably benign	Het
Cntrl	T	C	2: 35,149,461	I557T	probably damaging	Het
Col26a1	G	A	5: 136,847,550	S72F	probably damaging	Het
Crocc2	G	A	1: 93,168,794	V24M	possibly damaging	Het
Csmd1	T	C	8: 15,932,511	I2719V	possibly damaging	Het
Cul9	C	T	17: 46,539,017	W502*	probably null	Het
Dazl	A	T	17: 50,288,155	F84I	probably damaging	Het
Dcaf1	G	T	9: 106,846,807	R478L	probably benign	Het
Dock5	T	G	14: 67,842,779	I198L	probably benign	Het
Dock9	A	T	14: 121,586,246	L1428H	probably damaging	Het
Dync1li1	T	A	9: 114,709,169	V198E	probably damaging	Het
E130309D02Rik	A	T	5: 143,307,985	W246R	probably damaging	Het
Egf	A	T	3: 129,720,276	C429S	probably damaging	Het
Ehmt1	T	C	2: 24,891,684	E7G	probably null	Het
Ercc4	G	T	16: 13,147,574	R690L	probably damaging	Het
Erich5	T	C	15: 34,470,966	C114R	possibly damaging	Het
Etv1	T	C	12: 38,865,686	S428P	possibly damaging	Het
Fam19a5	T	G	15: 87,720,582	S115A	probably damaging	Het
Fbxo31	G	T	8: 121,560,016	F174L	probably benign	Het
Fbxo33	T	A	12: 59,204,431	I433L	probably benign	Het
Fez2	A	T	17: 78,412,928	V99E	probably damaging	Het
Gabarapl2	A	C	8: 111,942,553	K48Q	probably damaging	Het
Gfi1b	T	A	2: 28,610,137	H294L	probably damaging	Het
Gk2	A	G	5: 97,456,197	S261P	probably damaging	Het
Gm7534	G	A	4: 134,202,148	A282V	probably benign	Het
Gpr158	T	C	2: 21,827,053	I988T	probably benign	Het
Grk3	G	C	5: 112,929,720	H394D	probably benign	Het
Grm6	A	G	11: 50,857,206	E381G	probably benign	Het
Gtf3c1	A	T	7: 125,659,094	M1268K	possibly damaging	Het
Hikeshi	A	T	7: 89,923,646	I113N	probably damaging	Het
Hmg20b	T	A	10: 81,348,582	Q129L	probably damaging	Het
Hunk	C	A	16: 90,475,903	T365K	probably damaging	Het
Kdm5a	T	G	6: 120,374,977	V176G	possibly damaging	Het
Kif2a	T	A	13: 106,962,185	E691V	probably damaging	Het
Ly6e	T	C	15: 74,958,661		probably null	Het
Mettl25	A	G	10: 105,826,555	S185P	probably damaging	Het
Mfap3l	T	A	8: 60,671,150	V142D	probably damaging	Het
Mip	T	A	10: 128,227,053	H122Q	probably benign	Het
Mkx	G	A	18: 6,992,040	T280I	probably benign	Het
Msi1	A	T	5: 115,451,455		probably null	Het
Muc5b	A	G	7: 141,862,640	M3108V	probably benign	Het
Mybl1	A	G	1: 9,672,286	S625P	probably damaging	Het
Myo7b	C	A	18: 31,994,369	V627F	probably benign	Het
Ndst3	A	T	3: 123,672,035	I96N	probably damaging	Het
Nrp1	A	T	8: 128,457,944	T357S	probably benign	Het
Obscn	G	T	11: 59,124,570	Y1050*	probably null	Het
Olfr1212	T	A	2: 88,959,212	F249I	probably damaging	Het
Olfr1386	A	C	11: 49,470,624	I158L	probably benign	Het
Olfr152	T	C	2: 87,783,221	V227A	possibly damaging	Het
Olfr320	A	G	11: 58,684,730	N286D	probably damaging	Het
Olfr710	A	T	7: 106,944,340	N220K	probably benign	Het
Olfr74	A	T	2: 87,973,798	I289K	probably benign	Het
Otof	T	C	5: 30,383,570	E875G	possibly damaging	Het
Pick1	A	T	15: 79,248,937	D399V	probably benign	Het
Pik3c2g	T	A	6: 139,720,018	S22T	probably benign	Het
Pnpla2	A	G	7: 141,458,661	E276G	possibly damaging	Het
Pomk	A	T	8: 25,983,605	S107T	probably damaging	Het
Rbm46	A	T	3: 82,864,458	D283E	probably benign	Het
Rimbp3	A	G	16: 17,213,098	D1462G	probably damaging	Het
Rnf112	T	A	11: 61,452,110	E230V	probably damaging	Het
Rock1	T	C	18: 10,112,391	T455A	probably benign	Het
Rtp4	A	T	16: 23,610,040	M18L	probably benign	Het
Scaf11	A	T	15: 96,420,100		probably null	Het
Schip1	T	C	3: 68,064,964	V8A	probably benign	Het
Sec31b	T	C	19: 44,526,621	H351R	probably benign	Het
Sh3bp5l	A	G	11: 58,346,351	D378G	probably benign	Het
Soga1	T	C	2: 157,020,506	E1501G	probably damaging	Het
Sowahb	T	C	5: 93,042,856	D668G	probably damaging	Het
Spam1	A	G	6: 24,800,587	T442A	probably benign	Het
Syt14	T	A	1: 192,933,325	Y451F	probably damaging	Het
Tdh	A	G	14: 63,493,756	L323P	possibly damaging	Het
Tet2	A	T	3: 133,488,082	M197K	probably benign	Het
Thbs1	G	A	2: 118,118,329	A489T	probably benign	Het
Tnfaip1	C	T	11: 78,529,182	R88Q	probably damaging	Het
Tnn	T	C	1: 160,146,042	M252V	probably benign	Het
Trdn	G	T	10: 33,195,981	E215*	probably null	Het
Trim55	T	C	3: 19,671,122	F268L	probably benign	Het
Trmt112	T	A	19: 6,910,448	V55E	possibly damaging	Het
Tube1	A	G	10: 39,142,367	M147V	possibly damaging	Het
Ubn1	A	G	16: 5,077,987	T966A	probably damaging	Het
Unc80	A	G	1: 66,669,235	I2651V	probably benign	Het
Vmn1r172	G	A	7: 23,660,494	R268H	probably benign	Het
Vmn1r231	T	A	17: 20,890,309	I115F	probably damaging	Het
Vmn1r237	A	G	17: 21,314,138	K41R	probably benign	Het
Vmn2r58	A	T	7: 41,860,511	N547K	probably damaging	Het
Vmn2r74	T	C	7: 85,957,574	D188G	probably benign	Het
Vwa5b2	A	G	16: 20,596,329	K367R	probably damaging	Het
Washc4	T	A	10: 83,574,543	M665K	possibly damaging	Het
Wbp11	T	A	6: 136,821,191	Y236F	probably benign	Het
Wbp4	T	A	14: 79,472,361	I145F	possibly damaging	Het
Wwc2	C	A	8: 47,920,601	D77Y	probably damaging	Het

Other mutations in Map1b

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00508:Map1b	APN	13	99429233	missense	unknown
IGL00533:Map1b	APN	13	99432604	missense	unknown
IGL00801:Map1b	APN	13	99430097	missense	unknown
IGL01141:Map1b	APN	13	99434761	missense	probably damaging	1.00
IGL01418:Map1b	APN	13	99431830	missense	unknown
IGL01464:Map1b	APN	13	99432743	missense	unknown
IGL01690:Map1b	APN	13	99435004	missense	probably damaging	1.00
IGL01991:Map1b	APN	13	99429569	missense	unknown
IGL02245:Map1b	APN	13	99431528	missense	unknown
IGL02376:Map1b	APN	13	99435595	missense	probably damaging	1.00
IGL02380:Map1b	APN	13	99431143	missense	unknown
IGL02442:Map1b	APN	13	99508198	missense	probably damaging	1.00
IGL02465:Map1b	APN	13	99433406	missense	unknown
IGL02816:Map1b	APN	13	99441755	missense	probably damaging	1.00
IGL02859:Map1b	APN	13	99433036	missense	unknown
IGL02934:Map1b	APN	13	99435131	missense	probably benign	0.09
IGL02970:Map1b	APN	13	99430734	nonsense	probably null
IGL03148:Map1b	APN	13	99441695	missense	probably damaging	1.00
IGL03401:Map1b	APN	13	99427268	missense	unknown
IGL03138:Map1b	UTSW	13	99425826	missense	unknown
R0006:Map1b	UTSW	13	99435302	missense	probably damaging	1.00
R0006:Map1b	UTSW	13	99435302	missense	probably damaging	1.00
R0035:Map1b	UTSW	13	99435338	missense	probably damaging	1.00
R0069:Map1b	UTSW	13	99429848	missense	unknown
R0315:Map1b	UTSW	13	99431116	missense	unknown
R0539:Map1b	UTSW	13	99434018	missense	unknown
R0548:Map1b	UTSW	13	99431683	missense	unknown
R0613:Map1b	UTSW	13	99441641	missense	probably damaging	1.00
R0730:Map1b	UTSW	13	99429766	nonsense	probably null
R1103:Map1b	UTSW	13	99427466	splice site	probably benign
R1300:Map1b	UTSW	13	99432521	missense	unknown
R1353:Map1b	UTSW	13	99427326	missense	unknown
R1387:Map1b	UTSW	13	99432650	missense	unknown
R1481:Map1b	UTSW	13	99431171	missense	unknown
R1509:Map1b	UTSW	13	99431528	missense	unknown
R1521:Map1b	UTSW	13	99432739	missense	unknown
R1604:Map1b	UTSW	13	99429572	missense	unknown
R1649:Map1b	UTSW	13	99516478	missense	probably benign	0.03
R1651:Map1b	UTSW	13	99432583	missense	unknown
R1661:Map1b	UTSW	13	99431929	missense	unknown
R1665:Map1b	UTSW	13	99431929	missense	unknown
R1770:Map1b	UTSW	13	99430493	missense	unknown
R1926:Map1b	UTSW	13	99430692	missense	unknown
R1928:Map1b	UTSW	13	99430946	missense	unknown
R2093:Map1b	UTSW	13	99429670	missense	unknown
R2110:Map1b	UTSW	13	99431121	missense	unknown
R2116:Map1b	UTSW	13	99430644	missense	unknown
R2164:Map1b	UTSW	13	99429338	missense	unknown
R2207:Map1b	UTSW	13	99431083	missense	unknown
R2273:Map1b	UTSW	13	99432084	missense	unknown
R2443:Map1b	UTSW	13	99430411	missense	unknown
R3054:Map1b	UTSW	13	99432742	missense	unknown
R3766:Map1b	UTSW	13	99434087	missense	unknown
R3911:Map1b	UTSW	13	99431072	missense	unknown
R4005:Map1b	UTSW	13	99429907	missense	unknown
R4130:Map1b	UTSW	13	99431680	missense	unknown
R4513:Map1b	UTSW	13	99444233	missense	probably damaging	1.00
R4613:Map1b	UTSW	13	99430302	nonsense	probably null
R4633:Map1b	UTSW	13	99434942	missense	probably damaging	1.00
R4690:Map1b	UTSW	13	99431068	missense	unknown
R4704:Map1b	UTSW	13	99430475	missense	unknown
R4836:Map1b	UTSW	13	99431054	missense	unknown
R4916:Map1b	UTSW	13	99433300	missense	unknown
R4951:Map1b	UTSW	13	99432427	missense	unknown
R4960:Map1b	UTSW	13	99432212	missense	probably benign	0.23
R4961:Map1b	UTSW	13	99435653	missense	probably damaging	1.00
R5030:Map1b	UTSW	13	99434174	missense	unknown
R5090:Map1b	UTSW	13	99430026	nonsense	probably null
R5469:Map1b	UTSW	13	99429338	missense	unknown
R5820:Map1b	UTSW	13	99432824	missense	unknown
R5885:Map1b	UTSW	13	99430081	missense	unknown
R5915:Map1b	UTSW	13	99430331	missense	unknown
R5923:Map1b	UTSW	13	99433153	missense	unknown
R6063:Map1b	UTSW	13	99431137	missense	unknown
R6102:Map1b	UTSW	13	99425873	missense	unknown
R6218:Map1b	UTSW	13	99433206	missense	unknown
R6435:Map1b	UTSW	13	99516363	missense	probably damaging	0.99
R6663:Map1b	UTSW	13	99430022	missense	unknown
R6765:Map1b	UTSW	13	99425941	missense	unknown
R6860:Map1b	UTSW	13	99434767	missense	probably damaging	1.00
R6997:Map1b	UTSW	13	99430634	missense	unknown
R7001:Map1b	UTSW	13	99430593	missense	unknown
R7310:Map1b	UTSW	13	99433655	missense	unknown
R7349:Map1b	UTSW	13	99433640	missense	unknown
R7448:Map1b	UTSW	13	99508140	missense	probably damaging	0.99
R7449:Map1b	UTSW	13	99508140	missense	probably damaging	0.99
R7452:Map1b	UTSW	13	99508140	missense	probably damaging	0.99
R7810:Map1b	UTSW	13	99431882	missense	unknown
R7820:Map1b	UTSW	13	99431177	missense	unknown
R8396:Map1b	UTSW	13	99434113	missense	unknown
R8470:Map1b	UTSW	13	99516442	missense	probably damaging	0.98
R8535:Map1b	UTSW	13	99435154	missense	probably damaging	1.00
R8777:Map1b	UTSW	13	99430796	missense	unknown
R8777-TAIL:Map1b	UTSW	13	99430796	missense	unknown
R8812:Map1b	UTSW	13	99432815	missense	unknown
R8903:Map1b	UTSW	13	99432509	nonsense	probably null
R8928:Map1b	UTSW	13	99432116	missense	unknown
R8954:Map1b	UTSW	13	99434227	missense	unknown
R9164:Map1b	UTSW	13	99425843	missense	unknown
R9164:Map1b	UTSW	13	99432308	nonsense	probably null
R9190:Map1b	UTSW	13	99435406	missense	probably damaging	0.99
R9334:Map1b	UTSW	13	99431640	missense	unknown
R9339:Map1b	UTSW	13	99431062	missense	unknown
R9357:Map1b	UTSW	13	99430200	nonsense	probably null
R9430:Map1b	UTSW	13	99434108	missense	unknown
RF003:Map1b	UTSW	13	99430750	missense	unknown
X0019:Map1b	UTSW	13	99429968	missense	unknown
X0019:Map1b	UTSW	13	99432412	missense	unknown
Z1088:Map1b	UTSW	13	99508115	missense	probably benign	0.07

Predicted Primers

PCR Primer
(F):5'- TGTTCTTCAACTACTGCCTGGG -3'
(R):5'- TACTCCAAACCTGCTGTTGC -3'

Sequencing Primer
(F):5'- AACTACTGCCTGGGTCACTC -3'
(R):5'- CATTCAATGGATTGTCAGAAGGGTC -3'

Posted On

2015-10-08