Mutagenetix > Incidental Mutation

Incidental Mutation 'R3952:Ugt1a10'

356356

Institutional Source

Beutler Lab

Gene Symbol

Ugt1a10

Ensembl Gene

ENSMUSG00000090165

Gene Name

UDP glycosyltransferase 1 family, polypeptide A10

Synonyms

A13

MMRRC Submission

040829-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.147) question?

Stock #

R3952 (G1)

Quality Score

Status

Validated

Chromosome

Chromosomal Location

88055388-88219004 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to A at 88216140 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Histidine to Asparagine at position 361 (H361N)

Ref Sequence

ENSEMBL: ENSMUSP00000108760 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000014263] [ENSMUST00000049289] [ENSMUST00000058237] [ENSMUST00000073049] [ENSMUST00000073772] [ENSMUST00000097659] [ENSMUST00000113134] [ENSMUST00000113135] [ENSMUST00000113137] [ENSMUST00000113138] [ENSMUST00000113142] [ENSMUST00000113139] [ENSMUST00000173325] [ENSMUST00000140092] [ENSMUST00000150634] [ENSMUST00000138182] [ENSMUST00000126203]

AlphaFold

no structure available at present

Predicted Effect

probably damaging
Transcript: ENSMUST00000014263
AA Change: H361N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000014263
Gene: ENSMUSG00000054545
AA Change: H361N

Domain	Start	End	E-Value	Type
signal peptide	1	26	N/A	INTRINSIC
Pfam:UDPGT	27	522	1.2e-229	PFAM
Pfam:Glyco_tran_28_C	363	448	1e-8	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000049289
AA Change: H363N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000037258
Gene: ENSMUSG00000090171
AA Change: H363N

Domain	Start	End	E-Value	Type
signal peptide	1	27	N/A	INTRINSIC
Pfam:UDPGT	28	524	2.2e-247	PFAM
Pfam:Glyco_tran_28_C	363	452	4.5e-9	PFAM

Predicted Effect

possibly damaging
Transcript: ENSMUST00000058237
AA Change: H361N

PolyPhen 2 Score 0.946 (Sensitivity: 0.80; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000058683
Gene: ENSMUSG00000090124
AA Change: H361N

Domain	Start	End	E-Value	Type
signal peptide	1	25	N/A	INTRINSIC
Pfam:UDPGT	26	522	1.5e-234	PFAM
Pfam:Glyco_tran_28_C	361	450	4.5e-9	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000073049
AA Change: H365N

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000072803
Gene: ENSMUSG00000089960
AA Change: H365N

Domain	Start	End	E-Value	Type
signal peptide	1	29	N/A	INTRINSIC
Pfam:UDPGT	30	526	5.8e-241	PFAM
Pfam:Glyco_tran_28_C	365	454	4.5e-9	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000073772
AA Change: H358N

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000073444
Gene: ENSMUSG00000090175
AA Change: H358N

Domain	Start	End	E-Value	Type
signal peptide	1	23	N/A	INTRINSIC
Pfam:UDPGT	24	519	2.3e-232	PFAM
Pfam:Glyco_tran_28_C	358	447	4.5e-9	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000097659
AA Change: H359N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000095263
Gene: ENSMUSG00000089943
AA Change: H359N

Domain	Start	End	E-Value	Type
signal peptide	1	24	N/A	INTRINSIC
Pfam:UDPGT	25	520	6.7e-246	PFAM
Pfam:Glyco_tran_28_C	359	448	1.3e-9	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000113134
AA Change: H361N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000108759
Gene: ENSMUSG00000054545
AA Change: H361N

Domain	Start	End	E-Value	Type
signal peptide	1	26	N/A	INTRINSIC
Pfam:UDPGT	27	522	2.7e-232	PFAM
Pfam:Glyco_tran_28_C	361	450	4.5e-9	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000113135
AA Change: H361N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000108760
Gene: ENSMUSG00000090124
AA Change: H361N

Domain	Start	End	E-Value	Type
signal peptide	1	26	N/A	INTRINSIC
Pfam:UDPGT	27	522	1.2e-229	PFAM
Pfam:Glyco_tran_28_C	363	448	1e-8	PFAM

Predicted Effect

possibly damaging
Transcript: ENSMUST00000113137
AA Change: H361N

PolyPhen 2 Score 0.946 (Sensitivity: 0.80; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000108762
Gene: ENSMUSG00000090145
AA Change: H361N

Domain	Start	End	E-Value	Type
signal peptide	1	26	N/A	INTRINSIC
Pfam:UDPGT	27	522	1.3e-231	PFAM
Pfam:Glyco_tran_28_C	361	450	2.8e-9	PFAM

Predicted Effect

possibly damaging
Transcript: ENSMUST00000113138
AA Change: H361N

PolyPhen 2 Score 0.946 (Sensitivity: 0.80; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000108763
Gene: ENSMUSG00000090145
AA Change: H361N

Domain	Start	End	E-Value	Type
signal peptide	1	26	N/A	INTRINSIC
Pfam:UDPGT	27	522	7.3e-229	PFAM
Pfam:Glyco_tran_28_C	363	448	6.6e-9	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000113142
AA Change: H360N

PolyPhen 2 Score 0.974 (Sensitivity: 0.76; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000108767
Gene: ENSMUSG00000090165
AA Change: H360N

Domain	Start	End	E-Value	Type
signal peptide	1	25	N/A	INTRINSIC
Pfam:UDPGT	26	521	7.3e-231	PFAM
Pfam:Glyco_tran_28_C	360	449	1.3e-9	PFAM

Predicted Effect

possibly damaging
Transcript: ENSMUST00000113139
AA Change: H360N

PolyPhen 2 Score 0.946 (Sensitivity: 0.80; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000108764
Gene: ENSMUSG00000089675
AA Change: H360N

Domain	Start	End	E-Value	Type
signal peptide	1	25	N/A	INTRINSIC
Pfam:UDPGT	26	521	3.6e-237	PFAM
Pfam:Glyco_tran_28_C	360	449	1.3e-9	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000173325
AA Change: H161N

PolyPhen 2 Score 0.985 (Sensitivity: 0.74; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000134443
Gene: ENSMUSG00000090165
AA Change: H161N

Domain	Start	End	E-Value	Type
signal peptide	1	25	N/A	INTRINSIC
Pfam:UDPGT	26	61	3.4e-10	PFAM
Pfam:UDPGT	59	210	8.9e-92	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000140092
AA Change: H95N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000115642
Gene: ENSMUSG00000054545
AA Change: H95N

Domain	Start	End	E-Value	Type
Pfam:UDPGT	1	166	9.3e-98	PFAM
Pfam:Glyco_tran_28_C	96	166	4.9e-9	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000150634
AA Change: H136N

PolyPhen 2 Score 0.984 (Sensitivity: 0.74; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000123452
Gene: ENSMUSG00000090124
AA Change: H136N

Domain	Start	End	E-Value	Type
signal peptide	1	25	N/A	INTRINSIC
Pfam:UDPGT	26	62	9.5e-11	PFAM
Pfam:UDPGT	58	207	2e-90	PFAM
Pfam:Glyco_tran_28_C	137	207	4.8e-9	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000138182
AA Change: H136N

PolyPhen 2 Score 0.984 (Sensitivity: 0.74; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000119985
Gene: ENSMUSG00000090165
AA Change: H136N

Domain	Start	End	E-Value	Type
signal peptide	1	25	N/A	INTRINSIC
Pfam:UDPGT	26	62	7e-11	PFAM
Pfam:UDPGT	58	207	1.9e-90	PFAM
Pfam:Glyco_tran_28_C	137	207	4.8e-9	PFAM

Predicted Effect

silent
Transcript: ENSMUST00000126203

SMART Domains

Protein: ENSMUSP00000116653
Gene: ENSMUSG00000090124

Domain	Start	End	E-Value	Type
signal peptide	1	25	N/A	INTRINSIC
Pfam:UDPGT	26	62	4.6e-11	PFAM
Pfam:UDPGT	59	127	8.9e-24	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000173165

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000124852

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000174821

Meta Mutation Damage Score

0.9341

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.3%
20x: 95.1%

Validation Efficiency

98% (46/47)

Allele List at MGI

Other mutations in this stock

Total: 44 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700017N19Rik	T	C	10: 100,615,296		probably benign	Het
4833423E24Rik	T	C	2: 85,500,204		probably benign	Het
4932414N04Rik	T	C	2: 68,664,403		probably null	Het
Abi3bp	C	T	16: 56,604,038	T450I	possibly damaging	Het
Abl1	A	T	2: 31,784,537	T213S	probably damaging	Het
Apc2	C	T	10: 80,314,484	R1762W	probably damaging	Het
Arl2	G	T	19: 6,134,677	T182N	probably benign	Het
Brd8	C	G	18: 34,614,444		probably benign	Het
Cdh23	T	C	10: 60,657,326	Y3C	probably benign	Het
Clca3a2	A	G	3: 144,803,061	Y666H	probably damaging	Het
Cmya5	A	G	13: 93,089,199	V3127A	possibly damaging	Het
Copg1	G	A	6: 87,905,216	A598T	probably benign	Het
Dera	A	G	6: 137,837,120	Y100C	probably damaging	Het
Epha1	C	A	6: 42,364,285	L535F	probably damaging	Het
Epha4	A	T	1: 77,399,716	Y509N	probably damaging	Het
Ggcx	G	A	6: 72,426,558	G363R	probably benign	Het
Gm13101	C	T	4: 143,965,786	W215*	probably null	Het
Hjurp	G	C	1: 88,277,215		probably benign	Het
Kpna1	A	T	16: 36,002,882	T35S	probably benign	Het
Map3k20	T	G	2: 72,438,300	I550M	probably damaging	Het
Mgat4a	A	G	1: 37,450,414		probably benign	Het
Mrpl48	T	A	7: 100,559,923		probably benign	Het
Ncapd2	T	C	6: 125,186,784	K78E	probably damaging	Het
Ndst1	T	C	18: 60,697,139	N633S	probably benign	Het
Olfr1128	T	C	2: 87,545,065	T160A	probably damaging	Het
Olfr519	C	A	7: 108,893,982	V142L	probably benign	Het
Olfr816	A	G	10: 129,911,636	I214T	probably benign	Het
Pacs2	T	C	12: 113,061,113	S408P	probably damaging	Het
Pcx	C	T	19: 4,617,967	H506Y	probably benign	Het
Pla2g6	G	T	15: 79,313,096	P93T	probably damaging	Het
Prpmp5	G	A	6: 132,312,694	P56S	unknown	Het
Rcor1	A	G	12: 111,039,735		probably benign	Het
Rtn4ip1	T	A	10: 43,909,897		probably null	Het
Sytl2	T	A	7: 90,381,492		probably benign	Het
Tia1	T	C	6: 86,416,337	F53S	probably damaging	Het
Ticrr	T	C	7: 79,682,069	L776S	probably damaging	Het
Tmod1	A	G	4: 46,078,315	N41S	probably damaging	Het
Ttn	T	C	2: 76,752,795	I22585V	possibly damaging	Het
Ttn	A	T	2: 76,811,243	L5176Q	possibly damaging	Het
Vmn1r118	G	T	7: 20,912,008	Q114K	probably damaging	Het
Vps39	C	T	2: 120,350,175	R43Q	probably benign	Het
Vwa5b2	T	C	16: 20,598,361	*603Q	probably null	Het
Zeb1	G	A	18: 5,772,716	A1002T	probably benign	Het
Zxdc	A	G	6: 90,370,467		probably null	Het

Other mutations in Ugt1a10

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01126:Ugt1a10	APN	1	88055987	missense	possibly damaging	0.72
IGL02219:Ugt1a10	APN	1	88056058	missense	probably benign	0.00
IGL02511:Ugt1a10	APN	1	88055863	missense	probably damaging	1.00
IGL02990:Ugt1a10	APN	1	88055879	missense	probably damaging	1.00
PIT4142001:Ugt1a10	UTSW	1	88216158	small deletion	probably benign
R0201:Ugt1a10	UTSW	1	88215123	missense	probably damaging	1.00
R0201:Ugt1a10	UTSW	1	88218249	missense	probably damaging	1.00
R0522:Ugt1a10	UTSW	1	88218249	missense	probably damaging	1.00
R0525:Ugt1a10	UTSW	1	88218249	missense	probably damaging	1.00
R0554:Ugt1a10	UTSW	1	88056095	missense	probably damaging	1.00
R0748:Ugt1a10	UTSW	1	88215123	missense	probably damaging	1.00
R0811:Ugt1a10	UTSW	1	88056182	missense	probably benign	0.33
R0812:Ugt1a10	UTSW	1	88056182	missense	probably benign	0.33
R1129:Ugt1a10	UTSW	1	88055609	missense	probably benign
R1207:Ugt1a10	UTSW	1	88216254	missense	probably damaging	1.00
R1432:Ugt1a10	UTSW	1	88216260	missense	probably damaging	1.00
R1457:Ugt1a10	UTSW	1	88055711	missense	probably damaging	1.00
R1469:Ugt1a10	UTSW	1	88216254	missense	probably damaging	1.00
R1972:Ugt1a10	UTSW	1	88056047	missense	probably damaging	1.00
R1973:Ugt1a10	UTSW	1	88056047	missense	probably damaging	1.00
R2039:Ugt1a10	UTSW	1	88055981	missense	probably benign	0.32
R2307:Ugt1a10	UTSW	1	88055947	missense	probably benign	0.01
R3973:Ugt1a10	UTSW	1	88216140	missense	probably damaging	1.00
R4232:Ugt1a10	UTSW	1	88056210	missense	probably benign	0.39
R4392:Ugt1a10	UTSW	1	88215123	missense	probably damaging	1.00
R4393:Ugt1a10	UTSW	1	88215123	missense	probably damaging	1.00
R4402:Ugt1a10	UTSW	1	88215123	missense	probably damaging	1.00
R4417:Ugt1a10	UTSW	1	88055995	missense	probably benign
R4474:Ugt1a10	UTSW	1	88215928	intron	probably benign
R4476:Ugt1a10	UTSW	1	88215928	intron	probably benign
R4515:Ugt1a10	UTSW	1	88056197	missense	probably damaging	1.00
R4579:Ugt1a10	UTSW	1	88056116	missense	probably benign
R4582:Ugt1a10	UTSW	1	88055741	missense	possibly damaging	0.90
R4609:Ugt1a10	UTSW	1	88055482	start codon destroyed	possibly damaging	0.92
R4627:Ugt1a10	UTSW	1	88218390	missense	probably damaging	1.00
R4790:Ugt1a10	UTSW	1	88056287	missense	probably damaging	0.98
R4799:Ugt1a10	UTSW	1	88215928	intron	probably benign
R4910:Ugt1a10	UTSW	1	88215123	missense	probably damaging	1.00
R4915:Ugt1a10	UTSW	1	88055924	missense	probably damaging	1.00
R5110:Ugt1a10	UTSW	1	88056252	splice site	probably null
R5168:Ugt1a10	UTSW	1	88055809	missense	probably benign	0.01
R5329:Ugt1a10	UTSW	1	88216254	missense	probably damaging	1.00
R5373:Ugt1a10	UTSW	1	88055910	missense	probably damaging	0.98
R5374:Ugt1a10	UTSW	1	88055910	missense	probably damaging	0.98
R5615:Ugt1a10	UTSW	1	88216158	small deletion	probably benign
R6498:Ugt1a10	UTSW	1	88216140	missense	probably damaging	1.00
R6727:Ugt1a10	UTSW	1	88056257	splice site	probably null
R6809:Ugt1a10	UTSW	1	88055925	missense	probably damaging	0.98
R6924:Ugt1a10	UTSW	1	88055657	missense	probably damaging	0.99
R6967:Ugt1a10	UTSW	1	88215123	missense	probably damaging	1.00
R7913:Ugt1a10	UTSW	1	88055755	missense	probably benign	0.00
R9165:Ugt1a10	UTSW	1	88055787	missense	probably benign	0.00
R9264:Ugt1a10	UTSW	1	88055671	missense	possibly damaging	0.62
R9475:Ugt1a10	UTSW	1	88216260	missense	probably damaging	1.00
S24628:Ugt1a10	UTSW	1	88216158	small deletion	probably benign
X0013:Ugt1a10	UTSW	1	88216254	missense	probably damaging	1.00
Z1088:Ugt1a10	UTSW	1	88055842	missense	probably benign	0.20
Z1190:Ugt1a10	UTSW	1	88216158	small deletion	probably benign

Predicted Primers

PCR Primer
(F):5'- GACATCTTAGCTTGATTGTGGTCC -3'
(R):5'- ACCTACCTCTTGTTGTTGATGACAG -3'

Sequencing Primer
(F):5'- GTGGTCCGTACACATAAGACATTGC -3'
(R):5'- GGGCATTTTCCAAATCATCAGCAG -3'

Posted On

2015-11-06