Incidental Mutation 'R4781:Axin2'
ID366527
Institutional Source Beutler Lab
Gene Symbol Axin2
Ensembl Gene ENSMUSG00000000142
Gene Nameaxin 2
SynonymsAxil, Conductin
MMRRC Submission 042415-MU
Accession Numbers

Genbank: NM_015732; MGI: 1270862

Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4781 (G1)
Quality Score160
Status Validated
Chromosome11
Chromosomal Location108920349-108950783 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 108943856 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Glutamine at position 636 (L636Q)
Ref Sequence ENSEMBL: ENSMUSP00000102322 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000052915] [ENSMUST00000106711]
Predicted Effect probably damaging
Transcript: ENSMUST00000052915
AA Change: L701Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000051331
Gene: ENSMUSG00000000142
AA Change: L701Q

DomainStartEndE-ValueType
Pfam:AXIN1_TNKS_BD 9 73 8.1e-27 PFAM
RGS 81 200 4.7e-33 SMART
low complexity region 302 318 N/A INTRINSIC
coiled coil region 377 405 N/A INTRINSIC
Pfam:Axin_b-cat_bind 432 472 7.6e-13 PFAM
low complexity region 511 520 N/A INTRINSIC
DAX 758 840 1.42e-47 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000106711
AA Change: L636Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000102322
Gene: ENSMUSG00000000142
AA Change: L636Q

DomainStartEndE-ValueType
low complexity region 22 35 N/A INTRINSIC
RGS 81 200 4.7e-33 SMART
low complexity region 302 318 N/A INTRINSIC
coiled coil region 377 405 N/A INTRINSIC
Pfam:Axin_b-cat_bind 432 469 8.6e-22 PFAM
low complexity region 511 520 N/A INTRINSIC
DAX 693 775 1.42e-47 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139682
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143435
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144130
Meta Mutation Damage Score 0.1248 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.0%
Validation Efficiency 100% (74/74)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The Axin-related protein, Axin2, presumably plays an important role in the regulation of the stability of beta-catenin in the Wnt signaling pathway, like its rodent homologs, mouse conductin/rat axil. In mouse, conductin organizes a multiprotein complex of APC (adenomatous polyposis of the colon), beta-catenin, glycogen synthase kinase 3-beta, and conductin, which leads to the degradation of beta-catenin. Apparently, the deregulation of beta-catenin is an important event in the genesis of a number of malignancies. The AXIN2 gene has been mapped to 17q23-q24, a region that shows frequent loss of heterozygosity in breast cancer, neuroblastoma, and other tumors. Mutations in this gene have been associated with colorectal cancer with defective mismatch repair. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutant mice exhibit premature fusion of cranial sutures, enhanced expansion of osteoprogenitors, accelerated ossification, and increased osteoblast proliferation and differentiation. [provided by MGI curators]
Allele List at MGI

All alleles(2) : Targeted, other(1) Gene trapped(1)

Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310022A10Rik T A 7: 27,571,651 I157N probably damaging Het
Adgrl3 T C 5: 81,760,724 Y1165H probably damaging Het
Adra2a A G 19: 54,046,495 D94G probably damaging Het
Akr1c20 T A 13: 4,508,175 K197* probably null Het
Ankrd65 C T 4: 155,793,036 H335Y possibly damaging Het
BC147527 A C 13: 120,308,162 K6T possibly damaging Het
Camk1g G T 1: 193,356,344 T90N probably benign Het
Cd177 C A 7: 24,750,626 C528F probably damaging Het
Cntnap5a A T 1: 116,412,201 D730V possibly damaging Het
Crtap T C 9: 114,386,236 D195G probably benign Het
Csn1s2b A G 5: 87,819,093 S74G possibly damaging Het
Cyp3a16 T C 5: 145,456,112 R128G possibly damaging Het
Dnah7a A G 1: 53,425,208 F3675L probably benign Het
Dram2 T A 3: 106,571,676 W195R probably damaging Het
E130308A19Rik C T 4: 59,691,057 P297L probably benign Het
Eif3i T C 4: 129,595,273 S83G probably benign Het
Gabra1 G A 11: 42,133,661 P396S probably damaging Het
Gipr T A 7: 19,157,375 Y459F possibly damaging Het
Gm11677 C T 11: 111,724,711 noncoding transcript Het
Gm6981 T C 9: 52,002,756 noncoding transcript Het
Grin2d T C 7: 45,862,481 D180G probably damaging Het
Hectd4 T G 5: 121,306,107 probably null Het
Hhat T C 1: 192,686,979 probably benign Het
Hoxa6 A G 6: 52,206,420 L215P possibly damaging Het
Hsf4 G A 8: 105,274,752 probably null Het
Igf1r G A 7: 68,165,199 A283T possibly damaging Het
Ighv15-2 A G 12: 114,564,856 S25P probably damaging Het
Inpp5a C T 7: 139,478,005 T43I probably benign Het
Kmt2c T A 5: 25,443,825 E82V probably damaging Het
Lrrc31 A G 3: 30,687,377 probably benign Het
Mdga2 A G 12: 66,797,622 probably null Het
Mefv G A 16: 3,715,334 P358S probably benign Het
Mrgpra9 A G 7: 47,235,047 F291L possibly damaging Het
Mtmr3 A G 11: 4,488,435 L673P probably benign Het
Muc19 T C 15: 91,903,166 noncoding transcript Het
Myo5b A T 18: 74,744,681 T1584S possibly damaging Het
Olfr1375 A T 11: 51,048,480 R124S probably damaging Het
Olfr1427 T C 19: 12,099,367 T91A probably benign Het
Palld G T 8: 61,877,028 R272S probably benign Het
Pcnx3 T A 19: 5,687,130 N144Y probably damaging Het
Prf1 A G 10: 61,300,424 K160E probably damaging Het
Rasgrp1 G A 2: 117,291,709 A400V probably benign Het
Rnf150 A G 8: 82,864,152 Y48C probably damaging Het
Rpl11 G T 4: 136,050,288 Q170K probably benign Het
Scin G A 12: 40,081,764 A257V possibly damaging Het
Scn7a C A 2: 66,703,760 A524S possibly damaging Het
Sim1 T C 10: 50,983,785 L581S probably benign Het
Skor1 T C 9: 63,144,459 T715A probably benign Het
Slc22a26 A G 19: 7,790,135 V301A probably benign Het
Sorcs1 T C 19: 50,182,681 Y923C probably damaging Het
Src T A 2: 157,467,485 M304K possibly damaging Het
Srgap3 A T 6: 112,757,425 probably benign Het
Stard3 G A 11: 98,372,334 E72K possibly damaging Het
Svep1 T A 4: 58,070,340 N2482I probably damaging Het
Tbc1d23 T C 16: 57,218,415 K20R possibly damaging Het
Tfip11 G A 5: 112,333,399 E414K probably damaging Het
Tinag G T 9: 76,996,950 T397K possibly damaging Het
Traf7 C G 17: 24,510,438 probably benign Het
Trmt10b T A 4: 45,305,817 I164N probably damaging Het
Trpm1 A G 7: 64,235,052 D827G probably benign Het
Ube2u A T 4: 100,486,658 T85S probably benign Het
Ulk4 T C 9: 121,103,576 D1066G probably benign Het
Vmn2r72 T A 7: 85,737,861 I832F probably benign Het
Yipf1 A C 4: 107,336,158 E80D probably benign Het
Zfp40 T A 17: 23,175,655 R653W probably damaging Het
Zxdc A G 6: 90,372,553 T308A probably damaging Het
Other mutations in Axin2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00339:Axin2 APN 11 108923990 missense probably benign
IGL01094:Axin2 APN 11 108923675 missense probably damaging 0.99
IGL01563:Axin2 APN 11 108923805 missense probably damaging 0.97
IGL02088:Axin2 APN 11 108923616 missense probably damaging 1.00
IGL02724:Axin2 APN 11 108942946 missense possibly damaging 0.48
PIT4131001:Axin2 UTSW 11 108924003 missense possibly damaging 0.85
R0029:Axin2 UTSW 11 108924047 missense probably benign 0.01
R0052:Axin2 UTSW 11 108949270 missense probably damaging 1.00
R0112:Axin2 UTSW 11 108939397 missense possibly damaging 0.62
R0372:Axin2 UTSW 11 108923333 missense probably damaging 1.00
R0372:Axin2 UTSW 11 108924110 unclassified probably benign
R1200:Axin2 UTSW 11 108931550 missense probably damaging 0.98
R1924:Axin2 UTSW 11 108942968 missense probably benign 0.02
R2025:Axin2 UTSW 11 108943078 missense probably damaging 1.00
R2427:Axin2 UTSW 11 108923974 missense possibly damaging 0.93
R4210:Axin2 UTSW 11 108942576 missense possibly damaging 0.89
R4846:Axin2 UTSW 11 108942299 missense probably benign 0.00
R4956:Axin2 UTSW 11 108943078 missense probably damaging 1.00
R7365:Axin2 UTSW 11 108939376 missense possibly damaging 0.93
R7519:Axin2 UTSW 11 108942246 missense probably benign 0.00
R7662:Axin2 UTSW 11 108942456 missense possibly damaging 0.96
X0054:Axin2 UTSW 11 108923574 missense probably damaging 1.00
Z1177:Axin2 UTSW 11 108923474 missense not run
Predicted Primers PCR Primer
(F):5'- AGCTACCCATTGGAGTCTGC -3'
(R):5'- GAGAATCTGAGAGACCCCACTC -3'

Sequencing Primer
(F):5'- ACCCATTGGAGTCTGCCTGTG -3'
(R):5'- GAGAGACCCCACTCAGCCTTC -3'
Posted On2015-12-29