Incidental Mutation 'R4830:Slc43a2'
ID372753
Institutional Source Beutler Lab
Gene Symbol Slc43a2
Ensembl Gene ENSMUSG00000038178
Gene Namesolute carrier family 43, member 2
Synonyms7630402D21Rik
MMRRC Submission 042446-MU
Accession Numbers

Genbank: NM_001199283.1, NM_001199284.1, NM_173388.2; Ensembl: ENSMUST00000042561

Is this an essential gene? Possibly essential (E-score: 0.655) question?
Stock #R4830 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location75531694-75577575 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 75543293 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 99 (L99P)
Ref Sequence ENSEMBL: ENSMUSP00000126838 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000042561] [ENSMUST00000108433] [ENSMUST00000127226] [ENSMUST00000143035] [ENSMUST00000149727] [ENSMUST00000169547]
Predicted Effect probably damaging
Transcript: ENSMUST00000042561
AA Change: L99P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000046074
Gene: ENSMUSG00000038178
AA Change: L99P

DomainStartEndE-ValueType
transmembrane domain 20 39 N/A INTRINSIC
Pfam:MFS_1 58 393 2.9e-15 PFAM
transmembrane domain 426 448 N/A INTRINSIC
transmembrane domain 453 475 N/A INTRINSIC
transmembrane domain 482 504 N/A INTRINSIC
transmembrane domain 514 536 N/A INTRINSIC
low complexity region 538 550 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000108433
AA Change: L99P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000104071
Gene: ENSMUSG00000038178
AA Change: L99P

DomainStartEndE-ValueType
transmembrane domain 20 39 N/A INTRINSIC
Pfam:MFS_1 58 393 2.4e-15 PFAM
transmembrane domain 426 448 N/A INTRINSIC
transmembrane domain 453 475 N/A INTRINSIC
transmembrane domain 482 504 N/A INTRINSIC
transmembrane domain 514 536 N/A INTRINSIC
low complexity region 538 550 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000127226
AA Change: L99P

PolyPhen 2 Score 0.886 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000117264
Gene: ENSMUSG00000038178
AA Change: L99P

DomainStartEndE-ValueType
transmembrane domain 20 39 N/A INTRINSIC
transmembrane domain 87 109 N/A INTRINSIC
transmembrane domain 118 137 N/A INTRINSIC
transmembrane domain 147 166 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000143035
AA Change: L99P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000123101
Gene: ENSMUSG00000038178
AA Change: L99P

DomainStartEndE-ValueType
transmembrane domain 20 39 N/A INTRINSIC
transmembrane domain 87 109 N/A INTRINSIC
transmembrane domain 118 137 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000149727
AA Change: L99P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000116255
Gene: ENSMUSG00000038178
AA Change: L99P

DomainStartEndE-ValueType
transmembrane domain 13 35 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152775
Predicted Effect probably damaging
Transcript: ENSMUST00000169547
AA Change: L99P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000126838
Gene: ENSMUSG00000038178
AA Change: L99P

DomainStartEndE-ValueType
transmembrane domain 20 39 N/A INTRINSIC
Pfam:MFS_1 58 393 2.4e-15 PFAM
transmembrane domain 426 448 N/A INTRINSIC
transmembrane domain 453 475 N/A INTRINSIC
transmembrane domain 482 504 N/A INTRINSIC
transmembrane domain 514 536 N/A INTRINSIC
low complexity region 538 550 N/A INTRINSIC
Meta Mutation Damage Score 0.9186 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.7%
  • 20x: 93.5%
Validation Efficiency 97% (71/73)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the L-amino acid transporter-3 or SLC43 family of transporters. The encoded protein mediates sodium-, chloride-, and pH-independent transport of L-isomers of neutral amino acids, including leucine, phenylalanine, valine and methionine. This protein may contribute to the transfer of amino acids across the placental membrane to the fetus. [provided by RefSeq, Mar 2016]
PHENOTYPE: Mice homozygous for a knock-out allele display fetal growth retardation, abnormal placental amino acid transport, slow postnatal weight gain, malnutrition and postnatal lethality, likely as a result of impaired intestinal amino acid absorption. [provided by MGI curators]
Allele List at MGI

All alleles(8) : Targeted, knock-out(1) Gene trapped(7)

Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcd3 C A 3: 121,760,284 G643V probably damaging Het
Adamtsl1 A G 4: 86,356,382 E1225G probably damaging Het
Agbl5 G A 5: 30,890,715 R111H probably damaging Het
Ankle2 A C 5: 110,242,013 K446Q probably damaging Het
Boc A C 16: 44,490,157 M800R probably damaging Het
Ccnt1 A T 15: 98,543,451 N645K probably damaging Het
Cd93 G A 2: 148,443,379 Q16* probably null Het
Cpsf4l G T 11: 113,709,502 probably benign Het
Cuzd1 T A 7: 131,318,054 D111V probably damaging Het
Dab2 T C 15: 6,427,527 C232R probably benign Het
Dmpk A T 7: 19,087,528 Y237F probably damaging Het
Dnah6 T A 6: 73,044,762 T3526S possibly damaging Het
Dock2 T C 11: 34,273,767 probably null Het
Dsp G A 13: 38,192,864 V1542I probably benign Het
Dst T A 1: 34,198,505 probably null Het
Esd T C 14: 74,741,160 L54S probably damaging Het
Exd1 C T 2: 119,520,326 A485T probably benign Het
Gm3604 A T 13: 62,369,043 N500K probably damaging Het
Gm7102 C T 19: 61,175,926 G24R unknown Het
Grhl2 T A 15: 37,335,659 probably null Het
Gsto1 C T 19: 47,864,391 R222C probably benign Het
H2afy2 C T 10: 61,739,353 D355N possibly damaging Het
Inpp4a T A 1: 37,371,780 M343K probably damaging Het
Itpripl2 T C 7: 118,491,057 Q93R probably benign Het
Jakmip2 G A 18: 43,567,143 T450I probably benign Het
Kdm6b A T 11: 69,403,794 I1186N unknown Het
Kif1a T C 1: 93,021,209 probably null Het
Klhl20 T C 1: 161,098,376 K434R probably benign Het
Lemd3 T C 10: 120,931,948 D697G probably damaging Het
Lipo1 A G 19: 33,776,587 S383P probably damaging Het
Ltn1 C A 16: 87,379,694 K1741N probably damaging Het
Lvrn A T 18: 46,905,351 T991S probably damaging Het
Mast3 C A 8: 70,788,915 R151L possibly damaging Het
Muc4 G C 16: 32,753,919 R1265P probably benign Het
Myoz1 T C 14: 20,655,309 K14E probably damaging Het
Neb G T 2: 52,192,520 Q5450K probably damaging Het
Nedd1 T A 10: 92,686,258 N639I probably damaging Het
Nlrp4e A T 7: 23,336,740 N673Y probably benign Het
Nop53 C T 7: 15,942,204 R190Q probably damaging Het
Notch4 T C 17: 34,570,118 Y468H probably damaging Het
Obscn T C 11: 59,067,607 T3507A probably damaging Het
Olfr724 T C 14: 49,960,224 N283D probably damaging Het
Opn5 T C 17: 42,611,296 H5R probably benign Het
Patl1 T C 19: 11,925,151 M349T probably benign Het
Phactr3 A G 2: 178,284,018 N362S probably damaging Het
Pirb C T 7: 3,717,603 G299S probably benign Het
Rapgef5 G A 12: 117,756,074 R579Q probably damaging Het
Rgl1 T C 1: 152,554,330 D234G probably benign Het
Serpinb3a C T 1: 107,048,586 E122K probably benign Het
Slc22a15 T C 3: 101,875,603 probably benign Het
Slc25a12 A T 2: 71,296,805 V344E probably damaging Het
Smim27 G T 4: 40,269,719 probably null Het
Smtn A G 11: 3,520,736 probably benign Het
Szt2 A T 4: 118,369,248 Y3001N unknown Het
Tgfbr3 G T 5: 107,109,719 P825T probably damaging Het
Tnpo3 T C 6: 29,568,938 T472A probably benign Het
Trf T A 9: 103,227,915 D66V probably damaging Het
Vmn1r124 A G 7: 21,259,699 C307R probably damaging Het
Vps13b T A 15: 35,452,224 F656Y possibly damaging Het
Zic1 G T 9: 91,362,531 S358R probably damaging Het
Other mutations in Slc43a2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01790:Slc43a2 APN 11 75545751 splice site probably null
IGL03009:Slc43a2 APN 11 75572376 missense probably benign
IGL03145:Slc43a2 APN 11 75568437 missense probably benign 0.27
1mM(1):Slc43a2 UTSW 11 75566996 missense possibly damaging 0.80
R0051:Slc43a2 UTSW 11 75562850 missense probably damaging 1.00
R0051:Slc43a2 UTSW 11 75562850 missense probably damaging 1.00
R0133:Slc43a2 UTSW 11 75563577 missense probably benign 0.22
R0443:Slc43a2 UTSW 11 75544667 splice site probably benign
R0841:Slc43a2 UTSW 11 75566989 nonsense probably null
R1145:Slc43a2 UTSW 11 75566989 nonsense probably null
R1145:Slc43a2 UTSW 11 75566989 nonsense probably null
R1215:Slc43a2 UTSW 11 75562862 missense probably damaging 1.00
R1499:Slc43a2 UTSW 11 75562907 critical splice donor site probably null
R1943:Slc43a2 UTSW 11 75545741 splice site probably null
R2438:Slc43a2 UTSW 11 75563131 missense possibly damaging 0.90
R2512:Slc43a2 UTSW 11 75570577 missense probably damaging 1.00
R3726:Slc43a2 UTSW 11 75543154 splice site probably benign
R3804:Slc43a2 UTSW 11 75563598 missense probably benign 0.01
R5650:Slc43a2 UTSW 11 75545807 missense probably damaging 1.00
R6042:Slc43a2 UTSW 11 75570607 missense probably damaging 0.98
R6171:Slc43a2 UTSW 11 75563050 missense probably damaging 1.00
R6196:Slc43a2 UTSW 11 75568380 nonsense probably null
R6264:Slc43a2 UTSW 11 75567074 missense possibly damaging 0.90
R6597:Slc43a2 UTSW 11 75571855 missense probably damaging 1.00
R7681:Slc43a2 UTSW 11 75563673 missense probably benign 0.02
R7787:Slc43a2 UTSW 11 75563074 missense probably damaging 1.00
X0060:Slc43a2 UTSW 11 75532665 missense probably null 0.91
Predicted Primers PCR Primer
(F):5'- TCTTTGGGGAAGCCTACCTG -3'
(R):5'- CTGTGCCAGATACGGTAGTAATCC -3'

Sequencing Primer
(F):5'- TGGGGAAGCCTACCTGTTCTC -3'
(R):5'- CAGATACGGTAGTAATCCTGTCCAG -3'
Posted On2016-03-01