Mutagenetix > Incidental Mutations

Incidental Mutation 'R4921:Slc14a2'

378653

Institutional Source

Beutler Lab

Gene Symbol

Slc14a2

Ensembl Gene

ENSMUSG00000024552

Gene Name

solute carrier family 14 (urea transporter), member 2

Synonyms

UT-A5, UT-A3

MMRRC Submission

042523-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R4921 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

78146940-78209094 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to T at 78192188 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Alanine to Glutamic Acid at position 258 (A258E)

Ref Sequence

ENSEMBL: ENSMUSP00000025434 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000025434] [ENSMUST00000163367]

AlphaFold

no structure available at present

Predicted Effect

probably damaging
Transcript: ENSMUST00000025434
AA Change: A258E

PolyPhen 2 Score 0.969 (Sensitivity: 0.77; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000025434
Gene: ENSMUSG00000024552
AA Change: A258E

Domain	Start	End	E-Value	Type
low complexity region	11	25	N/A	INTRINSIC
low complexity region	31	43	N/A	INTRINSIC
low complexity region	82	97	N/A	INTRINSIC
Pfam:UT	128	423	1.9e-105	PFAM
low complexity region	460	471	N/A	INTRINSIC
Pfam:UT	591	886	7.5e-112	PFAM

Predicted Effect

possibly damaging
Transcript: ENSMUST00000163367
AA Change: A120E

PolyPhen 2 Score 0.684 (Sensitivity: 0.86; Specificity: 0.92)

SMART Domains

Protein: ENSMUSP00000126416
Gene: ENSMUSG00000024552
AA Change: A120E

Domain	Start	End	E-Value	Type
Pfam:UT	1	292	3.4e-113	PFAM

Coding Region Coverage

1x: 99.0%
3x: 98.1%
10x: 95.7%
20x: 90.3%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the urea transporter family. In mammalian cells, urea is the chief end product of nitrogen catabolism, and plays an important role in the urinary concentration mechanism. This protein is expressed in the inner medulla of the kidney, and mediates rapid transepithelial urea transport across the inner medullary collecting duct. Alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Sep 2011]
PHENOTYPE: Homozygous mice lacking the collecting duct specific isoforms display decreased urea permeability and urine osmolality and increased urine flow. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 98 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930522L14Rik	A	T	5: 109,737,796	N65K	probably benign	Het
Abcc9	T	C	6: 142,590,436	Y1524C	probably benign	Het
Acap1	A	G	11: 69,887,193	I102T	probably damaging	Het
Acvr2a	T	C	2: 48,893,541	V284A	possibly damaging	Het
Adam3	T	C	8: 24,684,614	M712V	probably benign	Het
Adck1	T	C	12: 88,441,138	V213A	probably benign	Het
Adgrl3	G	T	5: 81,512,110	W242L	probably damaging	Het
Alk	T	C	17: 71,904,315	T857A	probably benign	Het
Alms1	A	G	6: 85,628,546	T2393A	probably benign	Het
Ank3	C	T	10: 70,002,109	P240L	probably damaging	Het
Ankrd35	C	A	3: 96,684,824	L809M	possibly damaging	Het
Birc6	T	A	17: 74,650,099	L3690Q	probably damaging	Het
Bmp3	C	A	5: 98,872,061	F114L	probably damaging	Het
Cage1	G	A	13: 38,019,208	H627Y	probably benign	Het
Cars	T	C	7: 143,569,475	D468G	probably damaging	Het
Ccdc148	T	C	2: 58,829,802	E487G	probably damaging	Het
Ccdc80	A	T	16: 45,118,167	I746F	probably damaging	Het
Ccl25	A	G	8: 4,353,913	Q119R	possibly damaging	Het
Cdh24	C	T	14: 54,633,215	D178N	probably damaging	Het
Cdk12	A	T	11: 98,222,687	T766S	unknown	Het
Chst15	T	A	7: 132,247,884	T443S	probably benign	Het
Cnbp	T	C	6: 87,845,146	D125G	possibly damaging	Het
Cntn2	A	T	1: 132,516,032	V1003E	possibly damaging	Het
Crct1	A	G	3: 93,014,825		probably benign	Het
Dand5	C	T	8: 84,816,484	C121Y	probably damaging	Het
Dmkn	A	T	7: 30,771,233	D382V	probably damaging	Het
Dnase2b	T	A	3: 146,593,441	T86S	probably damaging	Het
Dusp8	GCCACCACCACCACCACCACCACC	GCCACCACCACCACCACCACC	7: 142,082,154		probably benign	Het
Eef1akmt1	C	T	14: 57,550,632	V90M	probably damaging	Het
Egfl7	G	T	2: 26,590,980	W168L	probably benign	Het
Ep400	A	G	5: 110,665,810	C2908R	probably damaging	Het
Espl1	A	G	15: 102,315,241	K1076E	probably damaging	Het
Exoc4	A	G	6: 33,910,517	N747D	probably benign	Het
Fancm	T	C	12: 65,077,141	V191A	probably benign	Het
Fbxo17	A	G	7: 28,732,789	D97G	probably benign	Het
Fer1l6	G	T	15: 58,600,311		probably null	Het
Flt4	T	C	11: 49,627,143	W337R	probably damaging	Het
Fpr-rs7	T	C	17: 20,113,820	H136R	possibly damaging	Het
Frem3	T	A	8: 80,613,136	I686N	possibly damaging	Het
Galnt9	A	G	5: 110,577,449	K84R	probably damaging	Het
Gfm2	T	A	13: 97,175,676	M760K	probably damaging	Het
Glis3	T	C	19: 28,666,104	T13A	probably damaging	Het
Gm13078	A	T	4: 143,728,326	K398M	possibly damaging	Het
H2-K1	A	G	17: 33,997,076	V323A	possibly damaging	Het
Hbb-bs	G	A	7: 103,826,720	A130V	probably damaging	Het
Herc2	T	A	7: 56,229,690	H4685Q	probably benign	Het
Ighv5-9-1	C	T	12: 113,736,294	R56H	possibly damaging	Het
Itgb4	A	G	11: 116,006,605	N1548S	probably benign	Het
Itpr3	T	C	17: 27,098,005	Y745H	probably damaging	Het
Kank3	G	T	17: 33,817,200	G14V	probably damaging	Het
Kif24	G	T	4: 41,394,329	S982Y	probably damaging	Het
Kifc5b	C	T	17: 26,921,023	R53W	probably damaging	Het
Krt39	A	G	11: 99,514,749	S442P	possibly damaging	Het
Lcat	G	A	8: 105,942,442	P67L	possibly damaging	Het
Maml2	T	C	9: 13,621,175	S562P	probably damaging	Het
Map3k8	G	A	18: 4,349,124	R65W	possibly damaging	Het
Mbd3	G	T	10: 80,395,576	R12S	probably damaging	Het
Msr1	T	C	8: 39,624,251	E106G	possibly damaging	Het
Myh4	T	A	11: 67,254,028	L1256Q	probably damaging	Het
Mypn	G	A	10: 63,147,936	T511M	possibly damaging	Het
Nub1	A	T	5: 24,701,469	N331I	probably benign	Het
Nup107	A	G	10: 117,770,511	V440A	possibly damaging	Het
Ofcc1	A	G	13: 40,214,517	F174L	probably benign	Het
Olfr1497	T	C	19: 13,795,465	I49V	probably benign	Het
Olfr597	A	T	7: 103,320,543	N44I	probably damaging	Het
Olfr975	A	C	9: 39,950,225	V182G	probably damaging	Het
Parp2	C	A	14: 50,819,268	L310I	probably damaging	Het
Pcdh20	A	G	14: 88,469,726	V46A	probably benign	Het
Pcdhgb6	A	G	18: 37,743,472	D411G	probably damaging	Het
Pkd1l2	T	C	8: 117,054,885	E807G	probably benign	Het
Pkd1l2	A	T	8: 117,072,549	N267K	probably damaging	Het
Rell1	C	A	5: 63,936,033	M126I	probably damaging	Het
Robo4	G	A	9: 37,402,560	E36K	probably benign	Het
Rpgrip1l	T	C	8: 91,261,009	S807G	probably benign	Het
Rpl10a	T	C	17: 28,330,852	V169A	probably benign	Het
Rubcn	C	T	16: 32,847,294	V166I	probably damaging	Het
Sall2	T	C	14: 52,315,393	E113G	possibly damaging	Het
Sars2	T	C	7: 28,752,438	S423P	possibly damaging	Het
Scaper	A	G	9: 55,892,235	I182T	probably benign	Het
Selp	A	G	1: 164,141,397	D522G	possibly damaging	Het
Sema4b	T	A	7: 80,198,756	I35N	possibly damaging	Het
Sgce	A	T	6: 4,694,153	F268I	probably damaging	Het
Slc17a9	T	C	2: 180,735,949	Y213H	probably benign	Het
Slc22a7	T	G	17: 46,436,933	I233L	probably benign	Het
Slc35f1	A	G	10: 53,062,602	Q210R	probably damaging	Het
Slc6a21	A	G	7: 45,288,310	E350G	possibly damaging	Het
Spata21	A	T	4: 141,112,091	D639V	probably damaging	Het
Svil	A	G	18: 5,108,631	D1519G	probably damaging	Het
Tbccd1	T	C	16: 22,841,899	T56A	probably benign	Het
Tigit	A	T	16: 43,662,017	I118N	probably damaging	Het
Tlr11	A	T	14: 50,362,885	Q776L	possibly damaging	Het
Tspan12	A	C	6: 21,835,449	I9S	possibly damaging	Het
Unc5c	T	A	3: 141,788,966	Y347N	probably damaging	Het
Unk	A	G	11: 116,054,945	T481A	probably benign	Het
Vmn1r192	A	C	13: 22,187,480	V190G	probably damaging	Het
Vnn3	A	T	10: 23,864,575	M259L	probably benign	Het
Zan	T	C	5: 137,408,370		probably benign	Het
Zdhhc6	T	C	19: 55,313,210	H113R	probably damaging	Het

Other mutations in Slc14a2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00429:Slc14a2	APN	18	78150438	missense	possibly damaging	0.65
IGL00763:Slc14a2	APN	18	78192238	missense	probably damaging	1.00
IGL01359:Slc14a2	APN	18	78154108	missense	probably benign	0.01
IGL01400:Slc14a2	APN	18	78192213	missense	probably damaging	1.00
IGL01450:Slc14a2	APN	18	78183530	missense	probably damaging	0.97
IGL01469:Slc14a2	APN	18	78155566	missense	probably damaging	0.98
IGL02231:Slc14a2	APN	18	78209021	missense	possibly damaging	0.92
IGL02340:Slc14a2	APN	18	78163126	missense	probably damaging	1.00
IGL02542:Slc14a2	APN	18	78209087	missense	probably benign
xi_ning	UTSW	18	78195747	missense	probably benign	0.01
IGL02991:Slc14a2	UTSW	18	78205834	start codon destroyed	probably null	0.77
R0131:Slc14a2	UTSW	18	78192123	missense	probably damaging	1.00
R0131:Slc14a2	UTSW	18	78192123	missense	probably damaging	1.00
R0132:Slc14a2	UTSW	18	78192123	missense	probably damaging	1.00
R0601:Slc14a2	UTSW	18	78157179	nonsense	probably null
R1677:Slc14a2	UTSW	18	78163204	missense	probably benign
R1749:Slc14a2	UTSW	18	78147080	missense	possibly damaging	0.67
R2014:Slc14a2	UTSW	18	78150386	splice site	probably benign
R2034:Slc14a2	UTSW	18	78183583	missense	probably damaging	0.99
R2264:Slc14a2	UTSW	18	78163089	splice site	probably benign
R2278:Slc14a2	UTSW	18	78159944	missense	probably benign	0.01
R2920:Slc14a2	UTSW	18	78158297	nonsense	probably null
R3878:Slc14a2	UTSW	18	78159074	missense	probably benign
R4086:Slc14a2	UTSW	18	78205783	missense	probably damaging	1.00
R4237:Slc14a2	UTSW	18	78207068	missense	probably damaging	1.00
R4238:Slc14a2	UTSW	18	78207068	missense	probably damaging	1.00
R4239:Slc14a2	UTSW	18	78207068	missense	probably damaging	1.00
R4300:Slc14a2	UTSW	18	78207068	missense	probably damaging	1.00
R4373:Slc14a2	UTSW	18	78207068	missense	probably damaging	1.00
R4375:Slc14a2	UTSW	18	78207068	missense	probably damaging	1.00
R4376:Slc14a2	UTSW	18	78207068	missense	probably damaging	1.00
R4440:Slc14a2	UTSW	18	78195747	missense	probably benign	0.01
R4551:Slc14a2	UTSW	18	78195853	missense	probably benign	0.02
R4636:Slc14a2	UTSW	18	78195792	missense	possibly damaging	0.88
R4749:Slc14a2	UTSW	18	78155581	missense	probably damaging	1.00
R4983:Slc14a2	UTSW	18	78150401	missense	probably damaging	0.98
R5114:Slc14a2	UTSW	18	78195748	missense	possibly damaging	0.62
R5164:Slc14a2	UTSW	18	78157272	missense	probably damaging	1.00
R5386:Slc14a2	UTSW	18	78185840	missense	possibly damaging	0.65
R5433:Slc14a2	UTSW	18	78208928	missense	probably damaging	1.00
R5558:Slc14a2	UTSW	18	78159166	missense	possibly damaging	0.94
R5571:Slc14a2	UTSW	18	78209067	missense	possibly damaging	0.73
R5693:Slc14a2	UTSW	18	78147014	missense	probably benign	0.23
R5715:Slc14a2	UTSW	18	78158336	missense	probably damaging	1.00
R5719:Slc14a2	UTSW	18	78209042	missense	probably benign	0.06
R6160:Slc14a2	UTSW	18	78158975	critical splice donor site	probably null
R6352:Slc14a2	UTSW	18	78209094	start codon destroyed	probably null
R6380:Slc14a2	UTSW	18	78146975	missense	probably benign	0.00
R6444:Slc14a2	UTSW	18	78154102	missense	probably damaging	0.98
R6480:Slc14a2	UTSW	18	78159082	missense	possibly damaging	0.80
R6732:Slc14a2	UTSW	18	78192174	missense	probably damaging	1.00
R7038:Slc14a2	UTSW	18	78159037	missense	probably damaging	0.98
R7553:Slc14a2	UTSW	18	78155588	missense	probably damaging	1.00
R7558:Slc14a2	UTSW	18	78192119	missense	probably benign	0.07
R7617:Slc14a2	UTSW	18	78159941	missense	probably benign
R7693:Slc14a2	UTSW	18	78154003	missense	possibly damaging	0.81
R7874:Slc14a2	UTSW	18	78160768	missense	probably benign	0.01
R8144:Slc14a2	UTSW	18	78184544	critical splice donor site	probably null
R9205:Slc14a2	UTSW	18	78195736	missense	probably benign	0.19
R9356:Slc14a2	UTSW	18	78184608	missense	probably null	0.02
Z1088:Slc14a2	UTSW	18	78195780	missense	probably damaging	1.00
Z1176:Slc14a2	UTSW	18	78157368	missense	probably damaging	1.00
Z1176:Slc14a2	UTSW	18	78157369	missense	possibly damaging	0.65

Predicted Primers

PCR Primer
(F):5'- TCATCTGATGTCTGTTGAAGGACAG -3'
(R):5'- GTGAACCACTAGAATCCCAAGGG -3'

Sequencing Primer
(F):5'- TGTTGAAGGACAGAATGTATAAGATG -3'
(R):5'- GACCGGGGATGGTAGACATTC -3'

Posted On

2016-04-15