Incidental Mutation 'R4939:Heatr5b'
ID382962
Institutional Source Beutler Lab
Gene Symbol Heatr5b
Ensembl Gene ENSMUSG00000039414
Gene NameHEAT repeat containing 5B
Synonyms2010013B10Rik, A230048G03Rik, D330050P16Rik
MMRRC Submission 042538-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.394) question?
Stock #R4939 (G1)
Quality Score225
Status Not validated
Chromosome17
Chromosomal Location78752906-78835381 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 78762260 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 1686 (E1686G)
Ref Sequence ENSEMBL: ENSMUSP00000094882 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000097281]
Predicted Effect probably benign
Transcript: ENSMUST00000097281
AA Change: E1686G

PolyPhen 2 Score 0.183 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000094882
Gene: ENSMUSG00000039414
AA Change: E1686G

DomainStartEndE-ValueType
SCOP:d1qbkb_ 46 491 4e-6 SMART
SCOP:d1qbkb_ 846 1338 2e-16 SMART
low complexity region 1641 1650 N/A INTRINSIC
low complexity region 2039 2057 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.6%
  • 20x: 93.4%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 85 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamtsl1 A T 4: 86,243,725 Y365F possibly damaging Het
Atp2a1 T C 7: 126,450,116 M585V probably benign Het
Brca1 A G 11: 101,508,050 V1572A probably benign Het
C1ql4 A T 15: 99,087,640 M30K probably damaging Het
Ccdc73 A G 2: 104,992,157 probably null Het
Cdk6 A T 5: 3,344,377 D4V probably null Het
Celf3 ACAGCAGCAGCAGCAGCAGCAGCA ACAGCAGCAGCAGCAGCAGCA 3: 94,488,230 probably benign Het
Clic4 T C 4: 135,223,541 E113G probably benign Het
Creld1 C A 6: 113,488,179 H122Q probably benign Het
Cyp4a29 G A 4: 115,247,676 probably null Het
Dnaaf3 A T 7: 4,527,145 S246R probably damaging Het
Dnah12 A T 14: 26,891,524 T3925S probably damaging Het
Dnajc21 T A 15: 10,449,597 D446V probably damaging Het
Dock8 A T 19: 25,122,400 Y629F probably damaging Het
E2f8 A T 7: 48,872,138 N405K probably benign Het
Flg A G 3: 93,279,847 N202S probably benign Het
Glyatl3 A G 17: 40,910,023 probably null Het
Gm10696 A T 3: 94,176,233 Y90* probably null Het
Gm38999 A G 7: 43,428,461 T63A possibly damaging Het
Gm4981 T C 10: 58,235,603 N263S probably benign Het
Grap A G 11: 61,660,298 Y52C probably damaging Het
Haus2 T A 2: 120,619,036 I187K probably damaging Het
Herc2 A G 7: 56,206,736 D3944G probably damaging Het
Hexdc A T 11: 121,207,716 M9L probably benign Het
Hoxa3 T C 6: 52,170,676 probably benign Het
Hspg2 A T 4: 137,508,031 I126F probably damaging Het
Itpr1 T A 6: 108,440,558 C123* probably null Het
Jmjd1c T A 10: 67,246,137 N2346K possibly damaging Het
Kctd9 A G 14: 67,729,686 Y37C probably damaging Het
Kmt5b A C 19: 3,815,245 S747R possibly damaging Het
Krt26 T C 11: 99,334,696 M320V probably benign Het
Lama1 T G 17: 67,737,475 V123G possibly damaging Het
Lamc2 T C 1: 153,126,836 D1103G probably damaging Het
Lepr A T 4: 101,733,438 K71I possibly damaging Het
Llgl1 A T 11: 60,709,979 probably null Het
Mcoln2 A T 3: 146,192,241 H39L probably benign Het
Myh11 T A 16: 14,239,507 T315S probably benign Het
Ncapd3 T C 9: 27,063,869 probably null Het
Nlrp9b G T 7: 20,024,496 V553F probably damaging Het
Nubpl A G 12: 52,181,095 N129S probably damaging Het
Nup214 C A 2: 31,983,159 T255K probably benign Het
Olfr1390 A G 11: 49,340,549 T6A probably benign Het
Olfr1469 T A 19: 13,410,855 N95K probably benign Het
Olfr218 T C 1: 173,203,463 Y36H possibly damaging Het
Olfr325 G T 11: 58,581,211 M122I probably damaging Het
Olfr464 G T 11: 87,914,124 P261T probably damaging Het
Olfr619 T C 7: 103,604,251 V199A probably benign Het
Orc3 G A 4: 34,593,126 Q256* probably null Het
Pbrm1 A G 14: 31,061,623 M566V probably damaging Het
Pde6b A G 5: 108,421,497 I357V probably benign Het
Pkdrej A G 15: 85,820,283 I484T possibly damaging Het
Plvap A G 8: 71,511,439 V93A probably benign Het
Plxna4 T C 6: 32,165,762 Y1586C probably damaging Het
Ppfia4 A T 1: 134,328,079 L196Q possibly damaging Het
Ptpn13 T G 5: 103,517,469 probably null Het
Ranbp17 T C 11: 33,219,223 N997S probably benign Het
Rpap2 G T 5: 107,603,625 probably null Het
Rrm1 T C 7: 102,466,924 V683A probably benign Het
Ruvbl1 A G 6: 88,483,039 probably null Het
Sh3pxd2a A G 19: 47,278,404 Y277H probably damaging Het
Shank1 C T 7: 44,326,162 P477S unknown Het
Shtn1 T C 19: 59,022,201 E278G probably benign Het
Skap2 T A 6: 51,922,323 I109F possibly damaging Het
Skiv2l2 T C 13: 112,909,892 D308G possibly damaging Het
Slc28a3 A C 13: 58,558,581 I615M probably benign Het
Slc4a11 A G 2: 130,684,868 L780P probably damaging Het
Slc5a4b T C 10: 76,081,467 E245G probably benign Het
Slfn8 C T 11: 83,003,285 A843T probably benign Het
Sncaip A T 18: 52,907,263 Q843L possibly damaging Het
Spidr T A 16: 16,140,746 K51* probably null Het
Tas2r123 T C 6: 132,847,845 V235A probably benign Het
Tgfbr3 T C 5: 107,130,469 D757G probably benign Het
Tmem132d A T 5: 127,796,075 V490D probably damaging Het
Top2a T A 11: 99,010,092 H557L probably damaging Het
Trafd1 A G 5: 121,375,191 I328T probably benign Het
Trappc11 G A 8: 47,519,665 A291V probably damaging Het
Tuba1c A G 15: 99,037,954 Y432C probably damaging Het
Utp11 T G 4: 124,683,250 R109S possibly damaging Het
Vmn1r159 T G 7: 22,842,891 T239P probably damaging Het
Vwce A T 19: 10,645,050 N239Y probably damaging Het
Yes1 T C 5: 32,645,113 probably null Het
Zfand6 A C 7: 84,615,822 *224G probably null Het
Zfp408 A T 2: 91,645,105 I668N probably damaging Het
Zfp647 TGCACG TGCACGCACG 15: 76,911,044 probably null Het
Zfp946 T C 17: 22,455,437 F391L probably damaging Het
Other mutations in Heatr5b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00338:Heatr5b APN 17 78803434 missense probably damaging 1.00
IGL00418:Heatr5b APN 17 78753141 missense probably damaging 1.00
IGL00786:Heatr5b APN 17 78824634 missense possibly damaging 0.95
IGL00840:Heatr5b APN 17 78765437 missense probably damaging 1.00
IGL01362:Heatr5b APN 17 78816338 splice site probably benign
IGL01419:Heatr5b APN 17 78796510 missense probably benign 0.19
IGL01447:Heatr5b APN 17 78829597 missense probably benign 0.00
IGL01591:Heatr5b APN 17 78808472 missense probably benign 0.01
IGL01743:Heatr5b APN 17 78824640 nonsense probably null
IGL01860:Heatr5b APN 17 78808480 missense probably damaging 0.98
IGL01862:Heatr5b APN 17 78796485 missense possibly damaging 0.96
IGL01984:Heatr5b APN 17 78796497 missense possibly damaging 0.63
IGL02045:Heatr5b APN 17 78808426 missense probably damaging 1.00
IGL02097:Heatr5b APN 17 78817514 missense probably damaging 1.00
IGL02168:Heatr5b APN 17 78831591 unclassified probably benign
IGL02399:Heatr5b APN 17 78827967 missense probably damaging 0.99
IGL02540:Heatr5b APN 17 78773572 missense probably damaging 1.00
IGL02719:Heatr5b APN 17 78815540 missense probably damaging 1.00
IGL02824:Heatr5b APN 17 78773680 missense probably damaging 1.00
IGL02965:Heatr5b APN 17 78753073 missense probably benign 0.37
IGL03032:Heatr5b APN 17 78760499 missense probably benign 0.45
IGL03243:Heatr5b APN 17 78763080 splice site probably benign
IGL03259:Heatr5b APN 17 78791556 missense probably damaging 1.00
IGL03349:Heatr5b APN 17 78755320 missense probably benign 0.01
R0124:Heatr5b UTSW 17 78826217 splice site probably benign
R0285:Heatr5b UTSW 17 78808453 missense probably benign 0.05
R0335:Heatr5b UTSW 17 78827946 missense probably benign 0.15
R0412:Heatr5b UTSW 17 78820854 missense probably benign 0.04
R0601:Heatr5b UTSW 17 78768545 missense probably benign
R0725:Heatr5b UTSW 17 78796396 missense probably benign 0.03
R1178:Heatr5b UTSW 17 78813269 missense probably damaging 1.00
R1444:Heatr5b UTSW 17 78753193 missense probably benign 0.17
R1444:Heatr5b UTSW 17 78755427 splice site probably benign
R1453:Heatr5b UTSW 17 78817563 missense probably damaging 1.00
R1469:Heatr5b UTSW 17 78808384 missense probably damaging 1.00
R1469:Heatr5b UTSW 17 78808384 missense probably damaging 1.00
R1506:Heatr5b UTSW 17 78753147 missense probably damaging 1.00
R1819:Heatr5b UTSW 17 78791511 missense probably damaging 0.98
R1835:Heatr5b UTSW 17 78773563 missense probably damaging 1.00
R1837:Heatr5b UTSW 17 78820751 missense possibly damaging 0.54
R1934:Heatr5b UTSW 17 78795918 missense possibly damaging 0.93
R2014:Heatr5b UTSW 17 78814184 missense probably damaging 1.00
R2037:Heatr5b UTSW 17 78829505 nonsense probably null
R2154:Heatr5b UTSW 17 78831444 missense probably benign 0.00
R2190:Heatr5b UTSW 17 78801756 missense probably damaging 1.00
R2191:Heatr5b UTSW 17 78773677 missense probably damaging 1.00
R2413:Heatr5b UTSW 17 78756861 critical splice donor site probably null
R3424:Heatr5b UTSW 17 78768404 missense possibly damaging 0.58
R3607:Heatr5b UTSW 17 78834217 missense probably damaging 1.00
R3759:Heatr5b UTSW 17 78824540 missense possibly damaging 0.94
R3761:Heatr5b UTSW 17 78829642 missense probably damaging 1.00
R4127:Heatr5b UTSW 17 78753174 missense possibly damaging 0.48
R4242:Heatr5b UTSW 17 78756922 missense probably benign 0.00
R4345:Heatr5b UTSW 17 78760511 missense possibly damaging 0.94
R4534:Heatr5b UTSW 17 78810596 missense possibly damaging 0.91
R4623:Heatr5b UTSW 17 78795119 missense possibly damaging 0.52
R4654:Heatr5b UTSW 17 78820701 missense possibly damaging 0.95
R4960:Heatr5b UTSW 17 78831584 missense probably benign 0.01
R5037:Heatr5b UTSW 17 78824510 missense probably benign 0.00
R5051:Heatr5b UTSW 17 78795274 missense probably damaging 1.00
R5153:Heatr5b UTSW 17 78795107 nonsense probably null
R5328:Heatr5b UTSW 17 78826362 missense possibly damaging 0.94
R5346:Heatr5b UTSW 17 78827986 missense probably benign 0.44
R5426:Heatr5b UTSW 17 78773713 missense probably damaging 1.00
R5470:Heatr5b UTSW 17 78821579 splice site probably null
R5472:Heatr5b UTSW 17 78801660 missense probably damaging 1.00
R5553:Heatr5b UTSW 17 78753351 splice site probably null
R5706:Heatr5b UTSW 17 78766875 splice site probably null
R5804:Heatr5b UTSW 17 78831522 missense probably damaging 0.97
R5978:Heatr5b UTSW 17 78806036 missense probably damaging 0.99
R6122:Heatr5b UTSW 17 78813173 missense possibly damaging 0.96
R6153:Heatr5b UTSW 17 78831441 missense possibly damaging 0.56
R6220:Heatr5b UTSW 17 78773677 missense probably damaging 1.00
R6221:Heatr5b UTSW 17 78766954 missense probably benign 0.05
R6255:Heatr5b UTSW 17 78803434 missense probably damaging 1.00
R6291:Heatr5b UTSW 17 78762097 missense probably benign 0.08
R6455:Heatr5b UTSW 17 78753073 missense probably benign 0.37
R6524:Heatr5b UTSW 17 78814106 missense possibly damaging 0.94
R6575:Heatr5b UTSW 17 78762989 missense probably damaging 1.00
R6899:Heatr5b UTSW 17 78803509 missense probably benign 0.03
R7084:Heatr5b UTSW 17 78810563 missense possibly damaging 0.68
R7138:Heatr5b UTSW 17 78827988 missense probably damaging 1.00
R7148:Heatr5b UTSW 17 78831434 missense probably damaging 0.99
R7382:Heatr5b UTSW 17 78803507 missense possibly damaging 0.64
R7420:Heatr5b UTSW 17 78808480 missense probably damaging 1.00
R7436:Heatr5b UTSW 17 78768533 missense probably benign
R7519:Heatr5b UTSW 17 78755217 missense probably benign
R7606:Heatr5b UTSW 17 78763026 missense probably benign
R7673:Heatr5b UTSW 17 78795983 missense probably damaging 0.97
X0022:Heatr5b UTSW 17 78760545 missense probably benign 0.38
Predicted Primers PCR Primer
(F):5'- AGATCCGAGAGAATGGCCAC -3'
(R):5'- GGTGAAATGGATTGCTCATGGC -3'

Sequencing Primer
(F):5'- ACAGCTGAGTTTTCATGGCC -3'
(R):5'- CTTTCAAGGAGGGGTCATCTAGCC -3'
Posted On2016-04-27