Incidental Mutation 'R5088:Alpk1'
ID 387558
Institutional Source Beutler Lab
Gene Symbol Alpk1
Ensembl Gene ENSMUSG00000028028
Gene Name alpha-kinase 1
Synonyms 8430410J10Rik
MMRRC Submission 042677-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R5088 (G1)
Quality Score 225
Status Validated
Chromosome 3
Chromosomal Location 127670310-127780527 bp(-) (GRCm38)
Type of Mutation splice site
DNA Base Change (assembly) A to G at 127685320 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000143223 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029662] [ENSMUST00000198955]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000029662
SMART Domains Protein: ENSMUSP00000029662
Gene: ENSMUSG00000028028

DomainStartEndE-ValueType
low complexity region 85 97 N/A INTRINSIC
low complexity region 618 628 N/A INTRINSIC
low complexity region 700 714 N/A INTRINSIC
low complexity region 902 914 N/A INTRINSIC
low complexity region 924 947 N/A INTRINSIC
Alpha_kinase 1008 1215 1.03e-81 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000159720
Predicted Effect noncoding transcript
Transcript: ENSMUST00000160586
Predicted Effect probably benign
Transcript: ENSMUST00000198955
SMART Domains Protein: ENSMUSP00000143223
Gene: ENSMUSG00000028028

DomainStartEndE-ValueType
low complexity region 85 97 N/A INTRINSIC
low complexity region 618 628 N/A INTRINSIC
low complexity region 700 714 N/A INTRINSIC
low complexity region 902 914 N/A INTRINSIC
low complexity region 924 947 N/A INTRINSIC
Alpha_kinase 1008 1215 1.03e-81 SMART
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 93.9%
Validation Efficiency 99% (72/73)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an alpha kinase. Mice which were homozygous for disrupted copies of this gene exhibited coordination defects (PMID: 21208416). Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Dec 2011]
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930522L14Rik A T 5: 109,736,073 C640S probably damaging Het
4931429L15Rik T C 9: 46,305,740 R246G probably benign Het
Aak1 T C 6: 86,944,480 probably null Het
Abcc5 A G 16: 20,376,662 L695P probably damaging Het
Alcam T A 16: 52,288,927 T328S probably damaging Het
Arel1 A G 12: 84,924,115 L642P probably damaging Het
Atrip T C 9: 109,059,896 D741G probably damaging Het
Bmp1 T C 14: 70,486,219 T726A possibly damaging Het
Bnip3 A G 7: 138,894,608 probably null Het
Cacng5 C G 11: 107,877,389 C264S possibly damaging Het
Calr4 T A 4: 109,244,662 probably benign Het
Cdhr1 T A 14: 37,089,465 T230S probably benign Het
Cdk16 T C X: 20,696,327 probably benign Het
Cenpj T C 14: 56,553,691 E337G probably damaging Het
Chd9 A G 8: 90,977,519 I694V possibly damaging Het
Chsy3 T A 18: 59,179,535 V360D probably damaging Het
Col16a1 C T 4: 130,079,195 T643M probably benign Het
Col5a1 G A 2: 28,018,602 W67* probably null Het
Cyp20a1 A T 1: 60,363,350 H198L probably damaging Het
Dnaic1 T A 4: 41,597,630 S38T probably benign Het
Dnaic1 T G 4: 41,632,251 S562A probably benign Het
Dpy19l4 G T 4: 11,303,357 T188K probably damaging Het
Ergic2 A G 6: 148,183,123 V304A probably damaging Het
Fam83a A G 15: 58,009,800 T342A probably benign Het
Fbxo7 A G 10: 86,021,920 probably benign Het
Gins4 T C 8: 23,237,068 E3G possibly damaging Het
Glis3 G A 19: 28,531,579 P335L probably benign Het
Golph3l A T 3: 95,617,190 T251S possibly damaging Het
Hnf4g C T 3: 3,657,121 A445V probably benign Het
Hykk A G 9: 54,946,479 I362V probably benign Het
Il6st G A 13: 112,490,555 V294M probably damaging Het
Itpr1 A G 6: 108,389,387 I92V probably damaging Het
Kdm4c T C 4: 74,334,699 L501P probably benign Het
Mpi G A 9: 57,550,604 T105M probably damaging Het
Mrpl37 A T 4: 107,064,722 L132H probably damaging Het
Muc5ac A T 7: 141,796,319 T600S possibly damaging Het
Npl A T 1: 153,509,144 I249N possibly damaging Het
Olfr1408 C T 1: 173,131,039 M59I probably damaging Het
Olfr849 A G 9: 19,441,771 N286S probably damaging Het
Pkd1 A G 17: 24,590,838 K3497E possibly damaging Het
Ptprt T C 2: 162,238,175 N235D probably benign Het
Rangap1 A C 15: 81,710,463 D388E probably benign Het
Rcvrn A T 11: 67,695,514 Q33L probably benign Het
Rif1 A T 2: 52,092,295 K524I possibly damaging Het
Rnf139 A T 15: 58,899,941 N605I possibly damaging Het
Ryr2 C A 13: 11,712,243 G2411* probably null Het
Scn3a A T 2: 65,472,299 S1268T probably damaging Het
Sema6a T A 18: 47,249,129 I784F probably damaging Het
Sgms2 C T 3: 131,330,356 V232M probably benign Het
Skint7 T C 4: 111,980,430 I135T possibly damaging Het
Smchd1 A T 17: 71,431,348 N507K possibly damaging Het
Spata31d1a A C 13: 59,701,152 probably null Het
Spata7 A T 12: 98,669,502 D527V probably benign Het
Srcap A G 7: 127,541,661 T1477A probably benign Het
Srl C A 16: 4,482,769 D375Y probably damaging Het
Stk4 A T 2: 164,083,688 K58* probably null Het
Svep1 T G 4: 58,120,648 H795P possibly damaging Het
Trak2 T A 1: 58,935,808 Q75L probably benign Het
Ubxn2a T A 12: 4,883,904 N169I probably damaging Het
Vmn1r216 T A 13: 23,099,303 L52* probably null Het
Vmn2r108 A T 17: 20,470,192 N459K possibly damaging Het
Vstm5 A G 9: 15,257,305 D55G possibly damaging Het
Wdr24 T A 17: 25,828,207 probably null Het
Zfp13 C A 17: 23,577,061 E179* probably null Het
Zfp839 T C 12: 110,868,176 S546P probably damaging Het
Other mutations in Alpk1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00096:Alpk1 APN 3 127681043 missense probably damaging 1.00
IGL00722:Alpk1 APN 3 127680213 missense probably benign 0.00
IGL01066:Alpk1 APN 3 127680225 missense probably benign 0.22
IGL01351:Alpk1 APN 3 127672362 missense probably damaging 0.97
IGL01412:Alpk1 APN 3 127679972 missense possibly damaging 0.60
IGL01469:Alpk1 APN 3 127677752 splice site probably null
IGL01585:Alpk1 APN 3 127679813 missense probably benign 0.01
IGL02308:Alpk1 APN 3 127729282 missense probably damaging 0.99
IGL02325:Alpk1 APN 3 127679903 missense probably benign 0.43
IGL02458:Alpk1 APN 3 127681319 critical splice donor site probably null
IGL02553:Alpk1 APN 3 127673321 missense probably damaging 1.00
IGL02717:Alpk1 APN 3 127681100 missense possibly damaging 0.76
IGL02729:Alpk1 APN 3 127681072 missense possibly damaging 0.87
IGL02832:Alpk1 APN 3 127679943 missense possibly damaging 0.63
IGL02892:Alpk1 APN 3 127680122 missense possibly damaging 0.92
IGL03178:Alpk1 APN 3 127680221 nonsense probably null
R0427:Alpk1 UTSW 3 127671071 missense probably damaging 1.00
R0981:Alpk1 UTSW 3 127679402 missense possibly damaging 0.62
R1174:Alpk1 UTSW 3 127680810 missense probably damaging 0.99
R1793:Alpk1 UTSW 3 127677798 missense probably damaging 1.00
R1859:Alpk1 UTSW 3 127681100 missense possibly damaging 0.76
R2173:Alpk1 UTSW 3 127683590 missense probably damaging 1.00
R2235:Alpk1 UTSW 3 127680920 missense probably benign 0.01
R2373:Alpk1 UTSW 3 127679808 missense probably benign 0.00
R3803:Alpk1 UTSW 3 127679837 missense possibly damaging 0.93
R3927:Alpk1 UTSW 3 127677716 missense probably damaging 1.00
R4356:Alpk1 UTSW 3 127729373 missense probably damaging 0.98
R4357:Alpk1 UTSW 3 127729373 missense probably damaging 0.98
R4358:Alpk1 UTSW 3 127729373 missense probably damaging 0.98
R4379:Alpk1 UTSW 3 127729373 missense probably damaging 0.98
R4381:Alpk1 UTSW 3 127729373 missense probably damaging 0.98
R4470:Alpk1 UTSW 3 127679526 missense probably damaging 1.00
R4471:Alpk1 UTSW 3 127679526 missense probably damaging 1.00
R4473:Alpk1 UTSW 3 127680018 missense probably damaging 0.97
R4474:Alpk1 UTSW 3 127680018 missense probably damaging 0.97
R4476:Alpk1 UTSW 3 127680018 missense probably damaging 0.97
R4512:Alpk1 UTSW 3 127684471 intron probably benign
R4594:Alpk1 UTSW 3 127683554 missense probably damaging 1.00
R4678:Alpk1 UTSW 3 127679858 missense probably damaging 0.99
R4707:Alpk1 UTSW 3 127687592 missense possibly damaging 0.50
R4784:Alpk1 UTSW 3 127687592 missense possibly damaging 0.50
R4785:Alpk1 UTSW 3 127687592 missense possibly damaging 0.50
R4820:Alpk1 UTSW 3 127671059 missense probably benign 0.06
R4887:Alpk1 UTSW 3 127673475 missense probably damaging 1.00
R5169:Alpk1 UTSW 3 127671101 missense probably damaging 1.00
R5280:Alpk1 UTSW 3 127681164 missense probably benign 0.00
R5351:Alpk1 UTSW 3 127729292 missense probably damaging 0.96
R5478:Alpk1 UTSW 3 127677719 missense probably damaging 1.00
R5627:Alpk1 UTSW 3 127680647 missense probably damaging 0.99
R5781:Alpk1 UTSW 3 127680035 missense possibly damaging 0.92
R5842:Alpk1 UTSW 3 127680969 missense probably damaging 1.00
R5847:Alpk1 UTSW 3 127680074 missense probably benign 0.06
R5940:Alpk1 UTSW 3 127670946 missense probably benign
R6187:Alpk1 UTSW 3 127673342 missense probably damaging 1.00
R6306:Alpk1 UTSW 3 127686316 missense probably damaging 1.00
R6414:Alpk1 UTSW 3 127680209 missense probably benign
R6701:Alpk1 UTSW 3 127729336 missense probably damaging 1.00
R6735:Alpk1 UTSW 3 127724449 missense probably damaging 1.00
R6850:Alpk1 UTSW 3 127729363 missense possibly damaging 0.87
R7173:Alpk1 UTSW 3 127684375 nonsense probably null
R7258:Alpk1 UTSW 3 127724466 missense probably damaging 1.00
R7412:Alpk1 UTSW 3 127672494 missense probably damaging 1.00
R7412:Alpk1 UTSW 3 127695733 missense probably damaging 1.00
R7498:Alpk1 UTSW 3 127679778 missense probably benign 0.22
R7635:Alpk1 UTSW 3 127695661 missense probably benign 0.01
R7660:Alpk1 UTSW 3 127680967 missense probably damaging 1.00
R7682:Alpk1 UTSW 3 127672546 missense possibly damaging 0.94
R7732:Alpk1 UTSW 3 127684392 missense
R7827:Alpk1 UTSW 3 127680051 missense probably benign 0.00
R8029:Alpk1 UTSW 3 127729285 missense possibly damaging 0.95
R8383:Alpk1 UTSW 3 127724436 missense probably benign 0.41
R8478:Alpk1 UTSW 3 127729312 missense probably damaging 1.00
R8765:Alpk1 UTSW 3 127672469 missense probably damaging 1.00
R8816:Alpk1 UTSW 3 127684375 nonsense probably null
R8907:Alpk1 UTSW 3 127680993 nonsense probably null
R8972:Alpk1 UTSW 3 127679583 missense probably damaging 1.00
R8974:Alpk1 UTSW 3 127679931 missense probably benign 0.03
R9039:Alpk1 UTSW 3 127679543 missense probably damaging 1.00
R9202:Alpk1 UTSW 3 127686289 missense
R9394:Alpk1 UTSW 3 127672538 missense probably damaging 1.00
R9421:Alpk1 UTSW 3 127673420 missense probably damaging 1.00
R9436:Alpk1 UTSW 3 127685275 missense
R9785:Alpk1 UTSW 3 127679945 missense probably benign 0.22
Z1176:Alpk1 UTSW 3 127673438 missense probably damaging 1.00
Z1177:Alpk1 UTSW 3 127685307 missense
Predicted Primers PCR Primer
(F):5'- CTAAATGTTCCTGGTCTTGTGC -3'
(R):5'- GGCTTTGTCAGTCTAATCTAACCTG -3'

Sequencing Primer
(F):5'- AATTAGACAGTGCAGTCAGAATTG -3'
(R):5'- GAGTCTTCCTAACAGGGTCCAATG -3'
Posted On 2016-06-06