Incidental Mutation 'R5175:Aox3'
ID399084
Institutional Source Beutler Lab
Gene Symbol Aox3
Ensembl Gene ENSMUSG00000064294
Gene Namealdehyde oxidase 3
SynonymsAOH1, 1200011D03Rik
MMRRC Submission 042755-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5175 (G1)
Quality Score225
Status Not validated
Chromosome1
Chromosomal Location58113130-58200698 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 58172328 bp
ZygosityHeterozygous
Amino Acid Change Proline to Serine at position 1015 (P1015S)
Ref Sequence ENSEMBL: ENSMUSP00000049391 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000040999]
PDB Structure
Crystal structure of the mouse liver Aldehyde Oxidase 3 (mAOX3) [X-RAY DIFFRACTION]
Predicted Effect probably benign
Transcript: ENSMUST00000040999
AA Change: P1015S

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000049391
Gene: ENSMUSG00000064294
AA Change: P1015S

DomainStartEndE-ValueType
Pfam:Fer2 12 82 1.4e-9 PFAM
Pfam:Fer2_2 91 165 1e-29 PFAM
Pfam:FAD_binding_5 239 419 1e-44 PFAM
CO_deh_flav_C 426 530 9.26e-24 SMART
Ald_Xan_dh_C 594 697 2.27e-41 SMART
Pfam:Ald_Xan_dh_C2 708 1241 8.7e-183 PFAM
low complexity region 1275 1286 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000160815
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.7%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Actr2 A C 11: 20,080,114 M215R probably benign Het
Ago2 A T 15: 73,124,218 I354K possibly damaging Het
Angel2 T A 1: 190,940,884 C72* probably null Het
Ank2 T A 3: 127,004,024 H679L probably damaging Het
Anks1 A T 17: 28,042,588 Q694L probably damaging Het
Arhgap35 C A 7: 16,562,599 R847L probably damaging Het
Bag4 C A 8: 25,768,351 C316F probably damaging Het
Camkv T A 9: 107,947,382 I258N probably damaging Het
Cpt1c G A 7: 44,971,357 A28V probably damaging Het
Cyp2j13 A T 4: 96,068,215 M219K possibly damaging Het
Dclk1 G T 3: 55,247,227 R26L possibly damaging Het
Diras2 A T 13: 52,507,971 I100N probably damaging Het
Dnah5 T A 15: 28,448,404 N4204K probably damaging Het
Dnase1l3 T A 14: 7,987,386 K55* probably null Het
Dusp6 A G 10: 99,264,002 D104G possibly damaging Het
Eif5b A G 1: 38,045,387 T819A probably damaging Het
Elfn2 A T 15: 78,673,873 L158H probably damaging Het
Erp44 T C 4: 48,196,823 T367A probably benign Het
Fasn A T 11: 120,816,369 D843E probably benign Het
Fbxw25 T C 9: 109,664,563 Y20C probably damaging Het
Fer1l6 G A 15: 58,550,277 G108E probably damaging Het
Fndc7 C T 3: 108,869,166 V520I probably benign Het
Gm17019 A G 5: 15,032,803 W46R possibly damaging Het
Gorab G T 1: 163,386,645 Q239K probably damaging Het
Gsdma2 A G 11: 98,652,612 T76A probably benign Het
Hnrnpll A C 17: 80,034,070 C513W possibly damaging Het
Ifrd2 T C 9: 107,590,625 L170P probably damaging Het
Itgb4 C T 11: 115,984,157 R447W probably benign Het
Kcnma1 A G 14: 23,336,038 probably null Het
Kcnn3 T C 3: 89,609,439 F385S probably damaging Het
Kif18a T G 2: 109,302,978 probably null Het
Llgl2 A G 11: 115,850,721 K559R probably damaging Het
Lrrc8a T C 2: 30,255,512 C113R probably damaging Het
Mgat5 A G 1: 127,459,912 N535S probably damaging Het
Myh15 T G 16: 49,069,426 W127G possibly damaging Het
Npsr1 A G 9: 24,134,815 R77G probably benign Het
Nub1 T A 5: 24,702,448 S376R probably benign Het
Olfr1040 T C 2: 86,145,957 Y259C probably damaging Het
Olfr1297 A T 2: 111,621,426 I216N possibly damaging Het
Olfr1426 G A 19: 12,088,562 P77S probably damaging Het
Olfr1501 G A 19: 13,838,316 P286S probably damaging Het
Olfr301 T C 7: 86,413,046 V228A probably benign Het
Pcdh9 A G 14: 93,888,443 L97P probably damaging Het
Pkn2 A G 3: 142,798,923 Y831H probably damaging Het
Plcz1 T G 6: 140,039,663 I51L possibly damaging Het
Plekhg1 T C 10: 3,965,516 probably benign Het
Prdm9 A T 17: 15,557,451 S124T probably benign Het
Prkag1 A C 15: 98,815,715 V33G possibly damaging Het
Rab25 T A 3: 88,543,421 Y57F possibly damaging Het
Rb1cc1 A G 1: 6,248,321 I638V probably benign Het
Rest C A 5: 77,268,372 D144E probably damaging Het
Rpa2 A G 4: 132,777,840 D260G probably damaging Het
Sf3b3 A G 8: 110,833,835 V425A probably benign Het
Sidt2 A T 9: 45,951,788 M15K probably damaging Het
Slc22a17 A G 14: 54,907,291 L555P probably damaging Het
Smoc2 A G 17: 14,375,457 D282G possibly damaging Het
Sorcs3 G A 19: 48,759,845 probably null Het
Srcin1 A G 11: 97,573,877 W15R probably damaging Het
Stra6l A G 4: 45,870,860 T259A probably benign Het
Thegl C T 5: 77,016,470 P107S probably benign Het
Ube3a T C 7: 59,288,717 F741S probably damaging Het
Vasp C A 7: 19,264,669 M54I probably benign Het
Vmn1r174 A T 7: 23,754,728 H273L probably benign Het
Vmn2r50 T A 7: 10,037,717 I686F probably damaging Het
Vmn2r76 T C 7: 86,228,707 E494G probably benign Het
Zfp788 A G 7: 41,649,329 E443G probably damaging Het
Other mutations in Aox3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01599:Aox3 APN 1 58169794 missense probably damaging 1.00
IGL01747:Aox3 APN 1 58159658 missense probably damaging 0.97
IGL01883:Aox3 APN 1 58138283 missense probably damaging 1.00
IGL01911:Aox3 APN 1 58152560 missense probably benign 0.04
IGL02017:Aox3 APN 1 58120992 missense probably damaging 1.00
IGL02120:Aox3 APN 1 58127650 missense probably benign 0.00
IGL02466:Aox3 APN 1 58158272 missense probably benign 0.28
IGL02545:Aox3 APN 1 58183486 missense probably damaging 1.00
IGL02572:Aox3 APN 1 58158367 missense probably damaging 1.00
IGL02746:Aox3 APN 1 58183542 missense possibly damaging 0.83
IGL02808:Aox3 APN 1 58142700 missense probably damaging 0.99
IGL02812:Aox3 APN 1 58165896 missense probably benign 0.00
IGL02982:Aox3 APN 1 58127687 missense probably benign 0.00
IGL03056:Aox3 APN 1 58159021 critical splice donor site probably null
IGL03182:Aox3 APN 1 58165887 missense probably benign 0.02
IGL03234:Aox3 APN 1 58152686 missense probably benign
IGL03374:Aox3 APN 1 58171848 missense probably damaging 1.00
amber UTSW 1 58171891 nonsense probably null
R0071:Aox3 UTSW 1 58171891 nonsense probably null
R0071:Aox3 UTSW 1 58171891 nonsense probably null
R0135:Aox3 UTSW 1 58125088 splice site probably benign
R0332:Aox3 UTSW 1 58142751 missense probably benign 0.00
R0626:Aox3 UTSW 1 58172299 missense possibly damaging 0.94
R1325:Aox3 UTSW 1 58176567 nonsense probably null
R1435:Aox3 UTSW 1 58163446 critical splice donor site probably null
R1438:Aox3 UTSW 1 58153178 missense probably benign
R1567:Aox3 UTSW 1 58194693 missense probably damaging 0.96
R1575:Aox3 UTSW 1 58152554 missense probably benign 0.04
R1759:Aox3 UTSW 1 58170646 splice site probably null
R1785:Aox3 UTSW 1 58169843 missense probably damaging 1.00
R1786:Aox3 UTSW 1 58169843 missense probably damaging 1.00
R1921:Aox3 UTSW 1 58180651 missense probably damaging 1.00
R1984:Aox3 UTSW 1 58153061 missense possibly damaging 0.88
R2012:Aox3 UTSW 1 58138232 missense probably benign 0.02
R2080:Aox3 UTSW 1 58186280 missense probably benign 0.06
R2121:Aox3 UTSW 1 58152549 splice site probably benign
R2126:Aox3 UTSW 1 58158216 missense probably benign 0.25
R2130:Aox3 UTSW 1 58169843 missense probably damaging 1.00
R2131:Aox3 UTSW 1 58169843 missense probably damaging 1.00
R2132:Aox3 UTSW 1 58169843 missense probably damaging 1.00
R2133:Aox3 UTSW 1 58169843 missense probably damaging 1.00
R2385:Aox3 UTSW 1 58138289 missense probably damaging 1.00
R2495:Aox3 UTSW 1 58188408 missense probably damaging 0.99
R4200:Aox3 UTSW 1 58188378 missense probably damaging 1.00
R4231:Aox3 UTSW 1 58114885 missense probably benign 0.12
R4591:Aox3 UTSW 1 58152656 missense probably damaging 0.99
R4627:Aox3 UTSW 1 58125035 missense probably damaging 0.98
R4831:Aox3 UTSW 1 58152566 missense probably damaging 0.97
R4864:Aox3 UTSW 1 58176487 missense probably damaging 1.00
R4976:Aox3 UTSW 1 58188524 critical splice donor site probably null
R5007:Aox3 UTSW 1 58163424 missense probably benign
R5119:Aox3 UTSW 1 58188524 critical splice donor site probably null
R5360:Aox3 UTSW 1 58146508 missense probably damaging 1.00
R5784:Aox3 UTSW 1 58153499 missense probably benign 0.00
R6050:Aox3 UTSW 1 58180655 missense possibly damaging 0.93
R6056:Aox3 UTSW 1 58169859 missense probably damaging 1.00
R6162:Aox3 UTSW 1 58159731 missense possibly damaging 0.75
R6181:Aox3 UTSW 1 58158946 missense probably benign 0.03
R6374:Aox3 UTSW 1 58172161 missense probably benign 0.11
R6662:Aox3 UTSW 1 58118615 missense probably damaging 1.00
R6809:Aox3 UTSW 1 58118681 missense probably damaging 0.99
R6810:Aox3 UTSW 1 58141431 missense probably benign 0.00
R6821:Aox3 UTSW 1 58150388 missense probably benign 0.04
R7039:Aox3 UTSW 1 58176555 missense probably damaging 1.00
R7116:Aox3 UTSW 1 58153530 missense probably benign 0.01
R7146:Aox3 UTSW 1 58158529 intron probably null
R7163:Aox3 UTSW 1 58119512 missense probably damaging 0.99
R7243:Aox3 UTSW 1 58138307 missense unknown
R7319:Aox3 UTSW 1 58152602 missense probably benign 0.04
R7423:Aox3 UTSW 1 58121069 missense possibly damaging 0.80
R7664:Aox3 UTSW 1 58119539 missense probably damaging 1.00
R7709:Aox3 UTSW 1 58180651 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CACCAGGTTCGAGAGCTAAAC -3'
(R):5'- ACCCCTGCCTTTGGAATTATTG -3'

Sequencing Primer
(F):5'- CCAGGTTCGAGAGCTAAACATGTAC -3'
(R):5'- CCAAGTTCTCAATCTGTGGGTCAAG -3'
Posted On2016-07-06