Incidental Mutation 'R5255:Slc3a1'
ID399542
Institutional Source Beutler Lab
Gene Symbol Slc3a1
Ensembl Gene ENSMUSG00000024131
Gene Namesolute carrier family 3, member 1
SynonymsNTAA, D2H
MMRRC Submission 042826-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5255 (G1)
Quality Score225
Status Not validated
Chromosome17
Chromosomal Location85028347-85064243 bp(+) (GRCm38)
Type of Mutationunclassified (4462 bp from exon)
DNA Base Change (assembly) A to T at 85028453 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000107926 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000024944] [ENSMUST00000112305] [ENSMUST00000112307]
Predicted Effect probably null
Transcript: ENSMUST00000024944
AA Change: R8*
SMART Domains Protein: ENSMUSP00000024944
Gene: ENSMUSG00000024131
AA Change: R8*

DomainStartEndE-ValueType
transmembrane domain 87 109 N/A INTRINSIC
Aamy 124 504 6.7e-110 SMART
Predicted Effect probably null
Transcript: ENSMUST00000112305
SMART Domains Protein: ENSMUSP00000107924
Gene: ENSMUSG00000061130

DomainStartEndE-ValueType
PP2Cc 13 293 1.57e-97 SMART
PP2C_SIG 38 295 2.6e-1 SMART
Blast:PP2Cc 296 341 6e-16 BLAST
Predicted Effect probably null
Transcript: ENSMUST00000112307
SMART Domains Protein: ENSMUSP00000107926
Gene: ENSMUSG00000061130

DomainStartEndE-ValueType
PP2Cc 13 293 1.57e-97 SMART
PP2C_SIG 38 295 2.6e-1 SMART
Blast:PP2Cc 296 341 5e-16 BLAST
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a type II membrane glycoprotein which is one of the components of the renal amino acid transporter which transports neutral and basic amino acids in the renal tubule and intestinal tract. Mutations and deletions in this gene are associated with cystinuria. Alternatively spliced transcript variants have been described, but their biological validity has not been determined. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mutation of this locus results in renal absorption defects and cystine urolithiasis. Homozygous mutant mice serve as a mouse model for human cystinuria type I. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921501E09Rik A T 17: 33,066,765 C354* probably null Het
Abcf1 A T 17: 35,959,737 probably null Het
Abr T A 11: 76,455,683 E434V probably damaging Het
Acaca T A 11: 84,311,307 L197Q probably damaging Het
Acot10 A G 15: 20,665,932 I241T probably benign Het
Acp6 T C 3: 97,167,996 V182A probably benign Het
Ahnak2 G A 12: 112,773,378 T1420I possibly damaging Het
Akr1c6 A T 13: 4,447,019 K153N probably benign Het
Ank3 T C 10: 69,885,200 L600P probably damaging Het
Arhgef1 G A 7: 24,925,022 A824T probably damaging Het
B230307C23Rik T A 16: 98,008,691 N22K possibly damaging Het
Btn1a1 A G 13: 23,464,154 probably benign Het
Cenpf G A 1: 189,672,627 T352I possibly damaging Het
Ces4a C A 8: 105,142,489 F185L probably benign Het
Clybl A C 14: 122,384,279 E293A probably benign Het
Cobl A G 11: 12,375,825 W217R probably damaging Het
D430041D05Rik T C 2: 104,256,600 N677S probably benign Het
Ddx51 C A 5: 110,656,042 T390N possibly damaging Het
Drd5 T G 5: 38,319,967 V101G probably damaging Het
Elmo3 C T 8: 105,307,353 P244L probably benign Het
Esrrg G A 1: 188,146,358 R189H probably damaging Het
Fxr2 A G 11: 69,643,841 T183A probably benign Het
Gjd4 T C 18: 9,280,613 H155R probably benign Het
Hivep2 T A 10: 14,131,267 probably null Het
Ints10 T C 8: 68,793,972 probably benign Het
Kank4 T C 4: 98,778,972 T413A probably benign Het
Mapkbp1 T C 2: 120,017,254 V568A probably damaging Het
Mobp A G 9: 120,168,353 probably benign Het
Mpst A G 15: 78,410,508 S147G probably benign Het
Myo5b A T 18: 74,662,670 Y559F possibly damaging Het
Nceh1 T C 3: 27,183,139 I21T probably damaging Het
Olfr1303 T C 2: 111,814,178 K183E probably benign Het
Ralgps1 A T 2: 33,276,159 V126E probably damaging Het
Rnls A G 19: 33,382,423 V115A probably damaging Het
Scn1a A T 2: 66,277,669 V1554D probably damaging Het
Slc16a11 T A 11: 70,215,432 D165E probably damaging Het
Slc16a5 A G 11: 115,462,675 T23A probably benign Het
Slc22a30 G A 19: 8,344,393 Q436* probably null Het
Slitrk6 A T 14: 110,749,753 *841K probably null Het
Syngr1 A G 15: 80,091,446 Y18C possibly damaging Het
Tarbp1 T G 8: 126,428,970 D1343A probably benign Het
Vac14 T A 8: 110,634,329 I177N probably damaging Het
Vmn1r218 A T 13: 23,136,711 D76V possibly damaging Het
Wdr75 T A 1: 45,799,117 I62N probably damaging Het
Zfp12 A T 5: 143,240,379 I68L probably null Het
Zswim8 T A 14: 20,721,651 Y1551N probably damaging Het
Other mutations in Slc3a1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00321:Slc3a1 APN 17 85060833 missense probably damaging 1.00
IGL00647:Slc3a1 APN 17 85063805 missense probably damaging 0.99
IGL02755:Slc3a1 APN 17 85037177 missense probably damaging 1.00
IGL03079:Slc3a1 APN 17 85059823 nonsense probably null
IGL03390:Slc3a1 APN 17 85032777 missense probably damaging 1.00
R0031:Slc3a1 UTSW 17 85032846 missense probably damaging 1.00
R0097:Slc3a1 UTSW 17 85032860 missense probably damaging 0.99
R0097:Slc3a1 UTSW 17 85032860 missense probably damaging 0.99
R0363:Slc3a1 UTSW 17 85032845 missense probably damaging 1.00
R0531:Slc3a1 UTSW 17 85028649 missense possibly damaging 0.66
R0636:Slc3a1 UTSW 17 85032794 missense possibly damaging 0.78
R0662:Slc3a1 UTSW 17 85037207 missense possibly damaging 0.89
R0725:Slc3a1 UTSW 17 85060835 nonsense probably null
R0930:Slc3a1 UTSW 17 85059743 missense probably benign 0.01
R1141:Slc3a1 UTSW 17 85028649 missense possibly damaging 0.66
R2025:Slc3a1 UTSW 17 85032845 missense probably damaging 1.00
R2271:Slc3a1 UTSW 17 85063792 missense probably benign 0.00
R4196:Slc3a1 UTSW 17 85060878 missense probably damaging 1.00
R4740:Slc3a1 UTSW 17 85046753 missense probably benign 0.00
R5049:Slc3a1 UTSW 17 85032845 missense probably damaging 1.00
R5261:Slc3a1 UTSW 17 85051975 missense probably damaging 1.00
R5601:Slc3a1 UTSW 17 85032891 missense probably benign 0.00
R5853:Slc3a1 UTSW 17 85032580 missense probably damaging 1.00
R6063:Slc3a1 UTSW 17 85028523 missense probably benign
R6332:Slc3a1 UTSW 17 85028432 start codon destroyed probably damaging 0.99
R7162:Slc3a1 UTSW 17 85064014 nonsense probably null
R7269:Slc3a1 UTSW 17 85032445 missense probably damaging 1.00
R7516:Slc3a1 UTSW 17 85063762 missense probably damaging 1.00
R7807:Slc3a1 UTSW 17 85063943 missense probably benign 0.09
X0020:Slc3a1 UTSW 17 85028808 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACGCAATCTTCCTTGGCTGG -3'
(R):5'- AGCCAGAAGAGGATCTCTCG -3'

Sequencing Primer
(F):5'- GCAATCTTCCTTGGCTGGACAAAG -3'
(R):5'- GAAGAGTACTTCCTTGGGCATCC -3'
Posted On2016-07-06