Incidental Mutation 'R5197:Ryr2'
ID 400382
Institutional Source Beutler Lab
Gene Symbol Ryr2
Ensembl Gene ENSMUSG00000021313
Gene Name ryanodine receptor 2, cardiac
Synonyms 9330127I20Rik
MMRRC Submission 042773-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R5197 (G1)
Quality Score 225
Status Validated
Chromosome 13
Chromosomal Location 11567988-12121831 bp(-) (GRCm39)
Type of Mutation critical splice donor site (2 bp from exon)
DNA Base Change (assembly) A to T at 11653316 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000152510 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021750] [ENSMUST00000021750] [ENSMUST00000170156] [ENSMUST00000170156] [ENSMUST00000221527] [ENSMUST00000221527]
AlphaFold no structure available at present
Predicted Effect probably null
Transcript: ENSMUST00000021750
SMART Domains Protein: ENSMUSP00000021750
Gene: ENSMUSG00000021313

DomainStartEndE-ValueType
MIR 110 165 4.19e-2 SMART
MIR 172 217 9.25e-4 SMART
MIR 225 280 1.8e-1 SMART
MIR 286 376 2.22e-24 SMART
Pfam:RYDR_ITPR 454 648 3.1e-65 PFAM
SPRY 670 808 1.56e-30 SMART
Pfam:RyR 862 952 1.8e-36 PFAM
Pfam:RyR 976 1066 1.1e-32 PFAM
SPRY 1098 1221 5.07e-39 SMART
SPRY 1423 1562 7.47e-28 SMART
low complexity region 1643 1653 N/A INTRINSIC
low complexity region 1872 1891 N/A INTRINSIC
Pfam:RYDR_ITPR 2122 2331 1.2e-71 PFAM
low complexity region 2372 2379 N/A INTRINSIC
low complexity region 2416 2426 N/A INTRINSIC
low complexity region 2497 2510 N/A INTRINSIC
Pfam:RyR 2700 2790 1.1e-33 PFAM
Pfam:RyR 2820 2904 7.1e-27 PFAM
PDB:2BCX|B 3580 3609 9e-12 PDB
low complexity region 3700 3720 N/A INTRINSIC
Pfam:RIH_assoc 3829 3947 3.1e-36 PFAM
EFh 4026 4054 1.36e0 SMART
EFh 4061 4089 5.92e1 SMART
low complexity region 4218 4227 N/A INTRINSIC
low complexity region 4256 4273 N/A INTRINSIC
transmembrane domain 4278 4300 N/A INTRINSIC
low complexity region 4309 4317 N/A INTRINSIC
Pfam:RR_TM4-6 4332 4598 5.7e-96 PFAM
Pfam:Ion_trans 4710 4877 8e-16 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000021750
SMART Domains Protein: ENSMUSP00000021750
Gene: ENSMUSG00000021313

DomainStartEndE-ValueType
MIR 110 165 4.19e-2 SMART
MIR 172 217 9.25e-4 SMART
MIR 225 280 1.8e-1 SMART
MIR 286 376 2.22e-24 SMART
Pfam:RYDR_ITPR 454 648 3.1e-65 PFAM
SPRY 670 808 1.56e-30 SMART
Pfam:RyR 862 952 1.8e-36 PFAM
Pfam:RyR 976 1066 1.1e-32 PFAM
SPRY 1098 1221 5.07e-39 SMART
SPRY 1423 1562 7.47e-28 SMART
low complexity region 1643 1653 N/A INTRINSIC
low complexity region 1872 1891 N/A INTRINSIC
Pfam:RYDR_ITPR 2122 2331 1.2e-71 PFAM
low complexity region 2372 2379 N/A INTRINSIC
low complexity region 2416 2426 N/A INTRINSIC
low complexity region 2497 2510 N/A INTRINSIC
Pfam:RyR 2700 2790 1.1e-33 PFAM
Pfam:RyR 2820 2904 7.1e-27 PFAM
PDB:2BCX|B 3580 3609 9e-12 PDB
low complexity region 3700 3720 N/A INTRINSIC
Pfam:RIH_assoc 3829 3947 3.1e-36 PFAM
EFh 4026 4054 1.36e0 SMART
EFh 4061 4089 5.92e1 SMART
low complexity region 4218 4227 N/A INTRINSIC
low complexity region 4256 4273 N/A INTRINSIC
transmembrane domain 4278 4300 N/A INTRINSIC
low complexity region 4309 4317 N/A INTRINSIC
Pfam:RR_TM4-6 4332 4598 5.7e-96 PFAM
Pfam:Ion_trans 4710 4877 8e-16 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000170156
SMART Domains Protein: ENSMUSP00000127991
Gene: ENSMUSG00000021313

DomainStartEndE-ValueType
MIR 110 165 4.19e-2 SMART
MIR 172 217 9.25e-4 SMART
MIR 225 280 1.8e-1 SMART
MIR 286 376 2.22e-24 SMART
Pfam:RYDR_ITPR 451 655 3.5e-73 PFAM
SPRY 670 808 1.56e-30 SMART
Pfam:RyR 861 955 1.4e-33 PFAM
Pfam:RyR 975 1069 9.2e-34 PFAM
SPRY 1098 1221 5.07e-39 SMART
SPRY 1423 1562 7.47e-28 SMART
low complexity region 1643 1653 N/A INTRINSIC
low complexity region 1872 1891 N/A INTRINSIC
Pfam:RYDR_ITPR 2120 2331 3.9e-65 PFAM
low complexity region 2372 2379 N/A INTRINSIC
low complexity region 2416 2426 N/A INTRINSIC
low complexity region 2497 2510 N/A INTRINSIC
Pfam:RyR 2699 2793 1.1e-37 PFAM
Pfam:RyR 2819 2907 9.4e-34 PFAM
PDB:2BCX|B 3580 3609 9e-12 PDB
low complexity region 3700 3720 N/A INTRINSIC
Pfam:RIH_assoc 3825 3958 2.3e-42 PFAM
EFh 4026 4054 1.36e0 SMART
EFh 4061 4089 5.92e1 SMART
low complexity region 4218 4227 N/A INTRINSIC
low complexity region 4256 4273 N/A INTRINSIC
transmembrane domain 4278 4300 N/A INTRINSIC
low complexity region 4309 4317 N/A INTRINSIC
Pfam:RR_TM4-6 4332 4598 5.1e-93 PFAM
Pfam:Ion_trans 4705 4865 9.3e-11 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000170156
SMART Domains Protein: ENSMUSP00000127991
Gene: ENSMUSG00000021313

DomainStartEndE-ValueType
MIR 110 165 4.19e-2 SMART
MIR 172 217 9.25e-4 SMART
MIR 225 280 1.8e-1 SMART
MIR 286 376 2.22e-24 SMART
Pfam:RYDR_ITPR 451 655 3.5e-73 PFAM
SPRY 670 808 1.56e-30 SMART
Pfam:RyR 861 955 1.4e-33 PFAM
Pfam:RyR 975 1069 9.2e-34 PFAM
SPRY 1098 1221 5.07e-39 SMART
SPRY 1423 1562 7.47e-28 SMART
low complexity region 1643 1653 N/A INTRINSIC
low complexity region 1872 1891 N/A INTRINSIC
Pfam:RYDR_ITPR 2120 2331 3.9e-65 PFAM
low complexity region 2372 2379 N/A INTRINSIC
low complexity region 2416 2426 N/A INTRINSIC
low complexity region 2497 2510 N/A INTRINSIC
Pfam:RyR 2699 2793 1.1e-37 PFAM
Pfam:RyR 2819 2907 9.4e-34 PFAM
PDB:2BCX|B 3580 3609 9e-12 PDB
low complexity region 3700 3720 N/A INTRINSIC
Pfam:RIH_assoc 3825 3958 2.3e-42 PFAM
EFh 4026 4054 1.36e0 SMART
EFh 4061 4089 5.92e1 SMART
low complexity region 4218 4227 N/A INTRINSIC
low complexity region 4256 4273 N/A INTRINSIC
transmembrane domain 4278 4300 N/A INTRINSIC
low complexity region 4309 4317 N/A INTRINSIC
Pfam:RR_TM4-6 4332 4598 5.1e-93 PFAM
Pfam:Ion_trans 4705 4865 9.3e-11 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000220712
Predicted Effect probably null
Transcript: ENSMUST00000220712
Predicted Effect probably null
Transcript: ENSMUST00000221527
Predicted Effect probably null
Transcript: ENSMUST00000221527
Predicted Effect noncoding transcript
Transcript: ENSMUST00000221916
Predicted Effect noncoding transcript
Transcript: ENSMUST00000221941
Meta Mutation Damage Score 0.9491 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.5%
Validation Efficiency 99% (67/68)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a ryanodine receptor found in cardiac muscle sarcoplasmic reticulum. The encoded protein is one of the components of a calcium channel, composed of a tetramer of the ryanodine receptor proteins and a tetramer of FK506 binding protein 1B proteins, that supplies calcium to cardiac muscle. Mutations in this gene are associated with stress-induced polymorphic ventricular tachycardia and arrhythmogenic right ventricular dysplasia. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mice show embryonic lethality during organogenesis and altered cardiomyocyte morphology. Homozygotes for a phosphorylation defective allele show decreased susceptibility to myocardial infarction-induced heart failure. Homozygotes for the R420W allele show lymphoid organ hypertrophy. [provided by MGI curators]
Allele List at MGI

All alleles(44) : Targeted(17) Gene trapped(27)
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acsbg1 T C 9: 54,529,866 (GRCm39) E247G possibly damaging Het
Adgra3 A G 5: 50,118,096 (GRCm39) F1151L probably benign Het
Afg3l2 G T 18: 67,554,329 (GRCm39) L458M probably damaging Het
Aldh4a1 A C 4: 139,375,612 (GRCm39) probably benign Het
Anln A T 9: 22,264,077 (GRCm39) probably null Het
Aste1 T C 9: 105,282,253 (GRCm39) S74P probably damaging Het
Atp6v0e2 G A 6: 48,517,051 (GRCm39) R77H probably benign Het
Brpf1 A G 6: 113,296,902 (GRCm39) D962G possibly damaging Het
Btbd2 T C 10: 80,482,253 (GRCm39) D249G probably damaging Het
Catsper3 T C 13: 55,955,989 (GRCm39) probably null Het
Cfap43 A G 19: 47,885,811 (GRCm39) L268P probably damaging Het
Cftr T C 6: 18,255,413 (GRCm39) V540A probably benign Het
Col22a1 C T 15: 71,881,255 (GRCm39) G32D probably damaging Het
Col5a2 G T 1: 45,432,241 (GRCm39) P804Q probably benign Het
Cyp2d41-ps A G 15: 82,662,981 (GRCm39) noncoding transcript Het
Cyp39a1 T G 17: 44,057,429 (GRCm39) L423V possibly damaging Het
Elmo1 T G 13: 20,748,607 (GRCm39) V484G probably benign Het
Eps8 C A 6: 137,467,288 (GRCm39) Q656H probably damaging Het
Eps8 T C 6: 137,467,289 (GRCm39) Q656R possibly damaging Het
Fshb T C 2: 106,887,854 (GRCm39) D55G possibly damaging Het
Garin1a G T 6: 29,281,221 (GRCm39) probably benign Het
H3c4 T A 13: 23,760,304 (GRCm39) L110Q probably damaging Het
Herc1 C A 9: 66,355,786 (GRCm39) Q2346K probably damaging Het
Htr3b T C 9: 48,856,815 (GRCm39) D221G probably benign Het
Ift74 T A 4: 94,550,833 (GRCm39) D328E probably benign Het
Kif21b A T 1: 136,072,363 (GRCm39) K23M probably damaging Het
Lgr6 C T 1: 134,921,748 (GRCm39) A199T probably damaging Het
Lipc T A 9: 70,705,673 (GRCm39) E470V probably benign Het
Lrrc4 G T 6: 28,830,142 (GRCm39) T68K probably damaging Het
Lrrc63 T A 14: 75,322,322 (GRCm39) H594L possibly damaging Het
Mfsd14a A T 3: 116,442,150 (GRCm39) probably benign Het
Mob2 T C 7: 141,563,274 (GRCm39) probably null Het
Nckap5 T A 1: 126,150,410 (GRCm39) H105L possibly damaging Het
Ngef C A 1: 87,437,090 (GRCm39) G133* probably null Het
Or14j2 T G 17: 37,886,111 (GRCm39) I68L probably benign Het
Or1e16 AGCGGTCGTAGGC AGC 11: 73,286,480 (GRCm39) probably null Het
Or2t1 T A 14: 14,328,462 (GRCm38) M117K probably damaging Het
Or52s1 G A 7: 102,861,207 (GRCm39) V47I probably benign Het
Or5b120 G T 19: 13,479,748 (GRCm39) V14F possibly damaging Het
Or5g23 T C 2: 85,438,791 (GRCm39) I154M probably benign Het
Pard3 A G 8: 127,800,040 (GRCm39) probably null Het
Pgm2 C T 5: 64,263,175 (GRCm39) A274V possibly damaging Het
Ppp1r9a T A 6: 5,156,177 (GRCm39) S1144R probably damaging Het
Pramel23 A C 4: 143,424,632 (GRCm39) C270W possibly damaging Het
Prkcq C T 2: 11,304,227 (GRCm39) P590L probably damaging Het
Psmd13 T A 7: 140,474,374 (GRCm39) probably null Het
Rab3gap1 T A 1: 127,816,931 (GRCm39) D63E probably benign Het
Rag2 C A 2: 101,461,085 (GRCm39) T465K probably damaging Het
Rnase6 A G 14: 51,367,670 (GRCm39) M21V unknown Het
Rufy4 T C 1: 74,186,822 (GRCm39) C537R probably damaging Het
Sash1 T G 10: 8,615,989 (GRCm39) R624S probably damaging Het
Slc1a2 A G 2: 102,586,460 (GRCm39) I355V probably benign Het
Srrm2 T C 17: 24,036,358 (GRCm39) S1097P probably benign Het
Sugct C T 13: 17,497,861 (GRCm39) A271T probably damaging Het
Tdrd7 T C 4: 46,034,350 (GRCm39) V1065A probably damaging Het
Tmprss6 T A 15: 78,338,389 (GRCm39) Y307F probably damaging Het
Tram1 T C 1: 13,642,126 (GRCm39) N216S probably benign Het
Ttk T C 9: 83,721,394 (GRCm39) V93A probably benign Het
Ubr4 A G 4: 139,195,408 (GRCm39) Y1210C probably damaging Het
Wdr7 A G 18: 63,871,937 (GRCm39) K364E probably benign Het
Xrcc2 G T 5: 25,897,656 (GRCm39) H98N probably benign Het
Zdhhc11 A G 13: 74,113,688 (GRCm39) I77V probably benign Het
Zfp54 C T 17: 21,654,442 (GRCm39) S312L probably benign Het
Zfp647 G A 15: 76,796,285 (GRCm39) P125L probably damaging Het
Other mutations in Ryr2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00518:Ryr2 APN 13 11,848,978 (GRCm39) splice site probably benign
IGL00757:Ryr2 APN 13 11,633,490 (GRCm39) splice site probably null
IGL00838:Ryr2 APN 13 11,583,389 (GRCm39) missense probably damaging 0.98
IGL00849:Ryr2 APN 13 11,600,364 (GRCm39) missense possibly damaging 0.91
IGL00987:Ryr2 APN 13 11,750,388 (GRCm39) missense probably damaging 0.99
IGL01096:Ryr2 APN 13 11,718,430 (GRCm39) missense probably damaging 1.00
IGL01313:Ryr2 APN 13 11,653,371 (GRCm39) critical splice acceptor site probably null
IGL01349:Ryr2 APN 13 11,602,125 (GRCm39) missense possibly damaging 0.93
IGL01391:Ryr2 APN 13 11,571,571 (GRCm39) missense possibly damaging 0.96
IGL01401:Ryr2 APN 13 11,606,238 (GRCm39) missense possibly damaging 0.80
IGL01412:Ryr2 APN 13 11,756,922 (GRCm39) missense probably benign 0.10
IGL01419:Ryr2 APN 13 11,814,723 (GRCm39) missense possibly damaging 0.51
IGL01432:Ryr2 APN 13 11,866,090 (GRCm39) missense possibly damaging 0.63
IGL01533:Ryr2 APN 13 11,736,676 (GRCm39) missense probably damaging 1.00
IGL01571:Ryr2 APN 13 11,736,647 (GRCm39) missense probably damaging 1.00
IGL01584:Ryr2 APN 13 11,616,644 (GRCm39) critical splice donor site probably null
IGL01611:Ryr2 APN 13 11,606,202 (GRCm39) missense possibly damaging 0.67
IGL01632:Ryr2 APN 13 11,609,854 (GRCm39) missense probably damaging 0.97
IGL01643:Ryr2 APN 13 11,707,563 (GRCm39) missense possibly damaging 0.94
IGL01647:Ryr2 APN 13 11,600,366 (GRCm39) missense probably damaging 1.00
IGL01730:Ryr2 APN 13 11,616,728 (GRCm39) missense possibly damaging 0.86
IGL01834:Ryr2 APN 13 11,610,311 (GRCm39) missense possibly damaging 0.71
IGL01921:Ryr2 APN 13 11,569,436 (GRCm39) missense possibly damaging 0.96
IGL01937:Ryr2 APN 13 11,805,249 (GRCm39) missense probably damaging 1.00
IGL01945:Ryr2 APN 13 11,805,249 (GRCm39) missense probably damaging 1.00
IGL02027:Ryr2 APN 13 11,611,998 (GRCm39) missense probably damaging 1.00
IGL02060:Ryr2 APN 13 11,762,450 (GRCm39) missense probably damaging 1.00
IGL02065:Ryr2 APN 13 11,587,143 (GRCm39) missense possibly damaging 0.92
IGL02084:Ryr2 APN 13 11,807,648 (GRCm39) nonsense probably null
IGL02086:Ryr2 APN 13 11,750,442 (GRCm39) missense probably damaging 1.00
IGL02095:Ryr2 APN 13 11,774,645 (GRCm39) missense probably damaging 0.98
IGL02100:Ryr2 APN 13 11,752,759 (GRCm39) missense possibly damaging 0.92
IGL02122:Ryr2 APN 13 11,756,755 (GRCm39) missense probably damaging 1.00
IGL02202:Ryr2 APN 13 11,745,274 (GRCm39) missense probably damaging 0.97
IGL02202:Ryr2 APN 13 11,762,544 (GRCm39) splice site probably benign
IGL02369:Ryr2 APN 13 11,634,382 (GRCm39) missense possibly damaging 0.68
IGL02383:Ryr2 APN 13 11,737,607 (GRCm39) splice site probably benign
IGL02400:Ryr2 APN 13 11,620,130 (GRCm39) splice site probably benign
IGL02423:Ryr2 APN 13 11,760,084 (GRCm39) missense probably damaging 1.00
IGL02425:Ryr2 APN 13 11,760,560 (GRCm39) missense probably damaging 0.99
IGL02458:Ryr2 APN 13 11,720,585 (GRCm39) missense probably benign 0.15
IGL02602:Ryr2 APN 13 11,569,397 (GRCm39) utr 3 prime probably benign
IGL02694:Ryr2 APN 13 11,620,075 (GRCm39) missense probably damaging 1.00
IGL02726:Ryr2 APN 13 11,753,206 (GRCm39) missense probably damaging 1.00
IGL02747:Ryr2 APN 13 11,670,563 (GRCm39) missense probably damaging 1.00
IGL02795:Ryr2 APN 13 11,610,076 (GRCm39) missense probably benign 0.21
IGL02876:Ryr2 APN 13 11,722,679 (GRCm39) missense probably benign 0.39
IGL02878:Ryr2 APN 13 11,933,205 (GRCm39) missense probably benign 0.10
IGL02887:Ryr2 APN 13 11,606,155 (GRCm39) missense probably damaging 0.97
IGL02926:Ryr2 APN 13 11,774,721 (GRCm39) missense probably damaging 0.99
IGL03030:Ryr2 APN 13 11,699,365 (GRCm39) missense probably damaging 0.99
IGL03064:Ryr2 APN 13 11,658,788 (GRCm39) critical splice acceptor site probably null
IGL03102:Ryr2 APN 13 11,650,468 (GRCm39) splice site probably benign
IGL03152:Ryr2 APN 13 11,868,036 (GRCm39) missense probably damaging 1.00
IGL03176:Ryr2 APN 13 11,756,909 (GRCm39) nonsense probably null
IGL03180:Ryr2 APN 13 11,583,449 (GRCm39) missense possibly damaging 0.95
IGL03213:Ryr2 APN 13 11,739,273 (GRCm39) splice site probably benign
IGL03390:Ryr2 APN 13 11,787,302 (GRCm39) missense probably benign
IGL03410:Ryr2 APN 13 11,603,033 (GRCm39) missense probably damaging 0.99
Arruda UTSW 13 11,658,781 (GRCm39) missense probably damaging 1.00
Arruda2 UTSW 13 11,894,382 (GRCm39) missense probably damaging 1.00
Arruda3 UTSW 13 11,570,334 (GRCm39) missense possibly damaging 0.91
barricuda UTSW 13 11,609,900 (GRCm39) missense probably benign 0.06
BB006:Ryr2 UTSW 13 11,705,181 (GRCm39) nonsense probably null
BB006:Ryr2 UTSW 13 11,609,680 (GRCm39) missense probably damaging 1.00
BB016:Ryr2 UTSW 13 11,705,181 (GRCm39) nonsense probably null
BB016:Ryr2 UTSW 13 11,609,680 (GRCm39) missense probably damaging 1.00
H8562:Ryr2 UTSW 13 11,732,027 (GRCm39) splice site probably benign
IGL02799:Ryr2 UTSW 13 11,680,848 (GRCm39) missense probably damaging 1.00
IGL02991:Ryr2 UTSW 13 11,776,192 (GRCm39) missense probably damaging 0.99
PIT4142001:Ryr2 UTSW 13 11,722,682 (GRCm39) missense probably damaging 0.97
PIT4260001:Ryr2 UTSW 13 11,609,641 (GRCm39) missense possibly damaging 0.93
PIT4458001:Ryr2 UTSW 13 11,570,334 (GRCm39) missense probably benign 0.29
R0003:Ryr2 UTSW 13 11,839,265 (GRCm39) missense probably damaging 1.00
R0004:Ryr2 UTSW 13 11,680,805 (GRCm39) missense probably benign
R0018:Ryr2 UTSW 13 11,610,109 (GRCm39) missense possibly damaging 0.94
R0048:Ryr2 UTSW 13 11,610,670 (GRCm39) missense probably damaging 1.00
R0048:Ryr2 UTSW 13 11,610,670 (GRCm39) missense probably damaging 1.00
R0056:Ryr2 UTSW 13 11,683,924 (GRCm39) missense probably damaging 0.97
R0062:Ryr2 UTSW 13 11,884,002 (GRCm39) critical splice donor site probably null
R0062:Ryr2 UTSW 13 11,884,002 (GRCm39) critical splice donor site probably null
R0080:Ryr2 UTSW 13 11,583,361 (GRCm39) missense probably damaging 0.98
R0116:Ryr2 UTSW 13 11,724,807 (GRCm39) missense probably damaging 1.00
R0148:Ryr2 UTSW 13 11,729,434 (GRCm39) missense probably damaging 1.00
R0206:Ryr2 UTSW 13 11,691,137 (GRCm39) splice site probably benign
R0226:Ryr2 UTSW 13 11,787,442 (GRCm39) missense probably damaging 1.00
R0285:Ryr2 UTSW 13 11,731,863 (GRCm39) missense probably damaging 1.00
R0365:Ryr2 UTSW 13 11,683,725 (GRCm39) missense possibly damaging 0.90
R0401:Ryr2 UTSW 13 11,720,570 (GRCm39) missense probably benign 0.45
R0415:Ryr2 UTSW 13 11,884,042 (GRCm39) missense probably damaging 0.97
R0418:Ryr2 UTSW 13 11,848,981 (GRCm39) splice site probably benign
R0558:Ryr2 UTSW 13 11,814,747 (GRCm39) missense probably damaging 1.00
R0558:Ryr2 UTSW 13 11,653,329 (GRCm39) missense probably damaging 1.00
R0574:Ryr2 UTSW 13 11,746,555 (GRCm39) missense probably benign 0.02
R0586:Ryr2 UTSW 13 11,650,445 (GRCm39) missense probably null
R0601:Ryr2 UTSW 13 11,720,519 (GRCm39) critical splice donor site probably null
R0610:Ryr2 UTSW 13 11,637,838 (GRCm39) missense probably damaging 1.00
R0648:Ryr2 UTSW 13 11,739,219 (GRCm39) missense possibly damaging 0.86
R0727:Ryr2 UTSW 13 11,581,771 (GRCm39) missense probably damaging 1.00
R0743:Ryr2 UTSW 13 11,569,415 (GRCm39) missense probably damaging 0.99
R0821:Ryr2 UTSW 13 11,753,012 (GRCm39) missense probably benign 0.35
R0884:Ryr2 UTSW 13 11,569,415 (GRCm39) missense probably damaging 0.99
R1104:Ryr2 UTSW 13 11,684,855 (GRCm39) missense probably damaging 0.99
R1114:Ryr2 UTSW 13 11,960,867 (GRCm39) missense probably damaging 0.98
R1167:Ryr2 UTSW 13 11,674,999 (GRCm39) missense possibly damaging 0.94
R1238:Ryr2 UTSW 13 11,774,589 (GRCm39) missense probably damaging 1.00
R1239:Ryr2 UTSW 13 11,897,929 (GRCm39) critical splice donor site probably null
R1296:Ryr2 UTSW 13 11,702,765 (GRCm39) splice site probably benign
R1400:Ryr2 UTSW 13 11,609,962 (GRCm39) missense probably benign 0.08
R1439:Ryr2 UTSW 13 11,729,389 (GRCm39) splice site probably benign
R1443:Ryr2 UTSW 13 11,794,152 (GRCm39) missense probably benign 0.19
R1446:Ryr2 UTSW 13 11,753,035 (GRCm39) missense probably benign 0.09
R1458:Ryr2 UTSW 13 11,741,908 (GRCm39) missense probably damaging 0.97
R1497:Ryr2 UTSW 13 11,616,727 (GRCm39) missense probably damaging 0.99
R1505:Ryr2 UTSW 13 11,569,478 (GRCm39) missense possibly damaging 0.84
R1548:Ryr2 UTSW 13 11,569,435 (GRCm39) nonsense probably null
R1551:Ryr2 UTSW 13 11,800,029 (GRCm39) critical splice acceptor site probably null
R1567:Ryr2 UTSW 13 11,774,563 (GRCm39) missense possibly damaging 0.87
R1581:Ryr2 UTSW 13 11,809,449 (GRCm39) missense probably benign 0.01
R1645:Ryr2 UTSW 13 11,733,368 (GRCm39) nonsense probably null
R1686:Ryr2 UTSW 13 11,618,665 (GRCm39) splice site probably benign
R1696:Ryr2 UTSW 13 11,746,543 (GRCm39) missense probably benign 0.02
R1708:Ryr2 UTSW 13 11,602,328 (GRCm39) splice site probably null
R1728:Ryr2 UTSW 13 11,602,308 (GRCm39) missense possibly damaging 0.94
R1745:Ryr2 UTSW 13 11,805,153 (GRCm39) missense probably damaging 1.00
R1771:Ryr2 UTSW 13 11,760,062 (GRCm39) critical splice donor site probably null
R1776:Ryr2 UTSW 13 11,760,062 (GRCm39) critical splice donor site probably null
R1783:Ryr2 UTSW 13 11,715,257 (GRCm39) nonsense probably null
R1801:Ryr2 UTSW 13 11,610,167 (GRCm39) missense probably benign 0.01
R1812:Ryr2 UTSW 13 11,575,472 (GRCm39) missense probably damaging 0.97
R1820:Ryr2 UTSW 13 11,602,202 (GRCm39) missense probably damaging 0.99
R1835:Ryr2 UTSW 13 11,784,764 (GRCm39) missense probably benign 0.06
R1868:Ryr2 UTSW 13 11,746,586 (GRCm39) missense probably benign 0.02
R1869:Ryr2 UTSW 13 11,676,961 (GRCm39) missense probably damaging 0.98
R1884:Ryr2 UTSW 13 11,753,242 (GRCm39) missense probably damaging 0.97
R1892:Ryr2 UTSW 13 11,673,844 (GRCm39) nonsense probably null
R1897:Ryr2 UTSW 13 11,765,818 (GRCm39) missense probably benign 0.09
R1899:Ryr2 UTSW 13 11,606,222 (GRCm39) missense probably benign
R1909:Ryr2 UTSW 13 11,715,235 (GRCm39) missense probably damaging 1.00
R1918:Ryr2 UTSW 13 11,571,584 (GRCm39) missense possibly damaging 0.91
R1937:Ryr2 UTSW 13 11,683,848 (GRCm39) missense probably damaging 1.00
R1943:Ryr2 UTSW 13 11,746,609 (GRCm39) missense probably benign 0.10
R1956:Ryr2 UTSW 13 11,695,966 (GRCm39) missense probably damaging 1.00
R1983:Ryr2 UTSW 13 11,600,288 (GRCm39) splice site probably null
R2018:Ryr2 UTSW 13 11,866,074 (GRCm39) missense possibly damaging 0.59
R2019:Ryr2 UTSW 13 11,866,074 (GRCm39) missense possibly damaging 0.59
R2060:Ryr2 UTSW 13 11,610,622 (GRCm39) missense probably damaging 1.00
R2061:Ryr2 UTSW 13 11,680,764 (GRCm39) splice site probably null
R2088:Ryr2 UTSW 13 11,677,115 (GRCm39) missense probably benign 0.04
R2089:Ryr2 UTSW 13 11,960,863 (GRCm39) missense probably benign 0.23
R2091:Ryr2 UTSW 13 11,960,863 (GRCm39) missense probably benign 0.23
R2091:Ryr2 UTSW 13 11,960,863 (GRCm39) missense probably benign 0.23
R2127:Ryr2 UTSW 13 11,727,081 (GRCm39) missense probably damaging 1.00
R2140:Ryr2 UTSW 13 11,575,493 (GRCm39) missense probably damaging 1.00
R2153:Ryr2 UTSW 13 11,592,759 (GRCm39) missense possibly damaging 0.86
R2179:Ryr2 UTSW 13 11,720,679 (GRCm39) nonsense probably null
R2207:Ryr2 UTSW 13 11,825,823 (GRCm39) missense probably damaging 1.00
R2237:Ryr2 UTSW 13 11,677,146 (GRCm39) missense probably benign 0.18
R2258:Ryr2 UTSW 13 11,753,102 (GRCm39) missense possibly damaging 0.94
R2312:Ryr2 UTSW 13 11,753,128 (GRCm39) missense probably damaging 1.00
R2421:Ryr2 UTSW 13 11,606,123 (GRCm39) missense probably damaging 0.98
R2438:Ryr2 UTSW 13 11,816,734 (GRCm39) missense probably damaging 1.00
R2483:Ryr2 UTSW 13 11,774,589 (GRCm39) missense probably damaging 1.00
R2860:Ryr2 UTSW 13 11,607,979 (GRCm39) missense probably damaging 0.98
R2861:Ryr2 UTSW 13 11,607,979 (GRCm39) missense probably damaging 0.98
R2867:Ryr2 UTSW 13 11,776,235 (GRCm39) missense probably damaging 1.00
R2867:Ryr2 UTSW 13 11,776,235 (GRCm39) missense probably damaging 1.00
R3618:Ryr2 UTSW 13 11,787,466 (GRCm39) critical splice acceptor site probably null
R3876:Ryr2 UTSW 13 11,603,045 (GRCm39) missense probably damaging 0.99
R3906:Ryr2 UTSW 13 11,753,095 (GRCm39) missense possibly damaging 0.87
R3912:Ryr2 UTSW 13 11,787,313 (GRCm39) missense probably damaging 0.99
R4018:Ryr2 UTSW 13 11,933,300 (GRCm39) missense probably damaging 1.00
R4114:Ryr2 UTSW 13 11,707,568 (GRCm39) missense probably damaging 1.00
R4119:Ryr2 UTSW 13 11,794,153 (GRCm39) missense probably benign 0.22
R4127:Ryr2 UTSW 13 11,602,323 (GRCm39) missense possibly damaging 0.91
R4222:Ryr2 UTSW 13 11,752,759 (GRCm39) missense possibly damaging 0.92
R4233:Ryr2 UTSW 13 11,765,611 (GRCm39) missense probably benign 0.20
R4355:Ryr2 UTSW 13 11,664,698 (GRCm39) missense probably benign 0.05
R4384:Ryr2 UTSW 13 11,620,119 (GRCm39) missense probably damaging 0.99
R4422:Ryr2 UTSW 13 11,731,952 (GRCm39) nonsense probably null
R4430:Ryr2 UTSW 13 11,750,413 (GRCm39) missense probably damaging 0.98
R4624:Ryr2 UTSW 13 12,121,301 (GRCm39) missense possibly damaging 0.47
R4663:Ryr2 UTSW 13 11,764,395 (GRCm39) missense possibly damaging 0.47
R4665:Ryr2 UTSW 13 11,765,571 (GRCm39) splice site probably null
R4668:Ryr2 UTSW 13 11,608,003 (GRCm39) missense probably benign
R4677:Ryr2 UTSW 13 11,721,553 (GRCm39) missense probably damaging 0.98
R4679:Ryr2 UTSW 13 11,839,255 (GRCm39) missense probably benign 0.34
R4680:Ryr2 UTSW 13 11,610,119 (GRCm39) missense probably benign 0.04
R4685:Ryr2 UTSW 13 11,707,532 (GRCm39) missense probably damaging 1.00
R4709:Ryr2 UTSW 13 11,731,884 (GRCm39) missense probably damaging 1.00
R4731:Ryr2 UTSW 13 11,592,795 (GRCm39) missense possibly damaging 0.53
R4732:Ryr2 UTSW 13 11,592,795 (GRCm39) missense possibly damaging 0.53
R4733:Ryr2 UTSW 13 11,592,795 (GRCm39) missense possibly damaging 0.53
R4734:Ryr2 UTSW 13 11,752,639 (GRCm39) missense probably damaging 0.99
R4740:Ryr2 UTSW 13 11,671,933 (GRCm39) missense possibly damaging 0.95
R4801:Ryr2 UTSW 13 11,723,113 (GRCm39) missense probably damaging 1.00
R4801:Ryr2 UTSW 13 11,702,818 (GRCm39) missense probably damaging 1.00
R4802:Ryr2 UTSW 13 11,702,818 (GRCm39) missense probably damaging 1.00
R4802:Ryr2 UTSW 13 11,723,113 (GRCm39) missense probably damaging 1.00
R4804:Ryr2 UTSW 13 11,731,983 (GRCm39) missense probably damaging 1.00
R4811:Ryr2 UTSW 13 11,670,584 (GRCm39) missense probably damaging 0.97
R4850:Ryr2 UTSW 13 11,760,638 (GRCm39) missense probably damaging 1.00
R4850:Ryr2 UTSW 13 11,683,706 (GRCm39) missense probably damaging 0.99
R4880:Ryr2 UTSW 13 11,767,104 (GRCm39) missense probably damaging 1.00
R4917:Ryr2 UTSW 13 11,609,872 (GRCm39) missense probably damaging 0.96
R4918:Ryr2 UTSW 13 11,609,872 (GRCm39) missense probably damaging 0.96
R4922:Ryr2 UTSW 13 11,724,849 (GRCm39) missense probably damaging 0.99
R4933:Ryr2 UTSW 13 11,960,831 (GRCm39) missense probably damaging 0.96
R4950:Ryr2 UTSW 13 11,756,897 (GRCm39) missense probably damaging 1.00
R4957:Ryr2 UTSW 13 11,799,966 (GRCm39) missense probably damaging 0.97
R4964:Ryr2 UTSW 13 11,848,878 (GRCm39) missense probably benign 0.00
R4964:Ryr2 UTSW 13 11,729,497 (GRCm39) missense possibly damaging 0.49
R4966:Ryr2 UTSW 13 11,729,497 (GRCm39) missense possibly damaging 0.49
R4966:Ryr2 UTSW 13 11,848,878 (GRCm39) missense probably benign 0.00
R4997:Ryr2 UTSW 13 11,610,192 (GRCm39) missense probably benign 0.09
R4998:Ryr2 UTSW 13 11,658,781 (GRCm39) missense probably damaging 1.00
R5033:Ryr2 UTSW 13 11,602,140 (GRCm39) missense possibly damaging 0.93
R5061:Ryr2 UTSW 13 11,650,422 (GRCm39) missense possibly damaging 0.74
R5062:Ryr2 UTSW 13 11,715,240 (GRCm39) missense probably damaging 0.97
R5088:Ryr2 UTSW 13 11,727,129 (GRCm39) nonsense probably null
R5135:Ryr2 UTSW 13 11,677,016 (GRCm39) missense probably benign 0.05
R5138:Ryr2 UTSW 13 11,675,175 (GRCm39) missense probably damaging 1.00
R5168:Ryr2 UTSW 13 11,767,207 (GRCm39) missense probably benign
R5187:Ryr2 UTSW 13 11,787,338 (GRCm39) missense probably damaging 0.99
R5262:Ryr2 UTSW 13 11,787,323 (GRCm39) missense probably damaging 0.99
R5325:Ryr2 UTSW 13 11,705,249 (GRCm39) missense probably damaging 0.97
R5381:Ryr2 UTSW 13 11,571,544 (GRCm39) missense probably damaging 1.00
R5437:Ryr2 UTSW 13 11,670,599 (GRCm39) missense probably damaging 1.00
R5477:Ryr2 UTSW 13 11,720,542 (GRCm39) missense probably damaging 1.00
R5497:Ryr2 UTSW 13 11,720,587 (GRCm39) missense probably null 0.15
R5509:Ryr2 UTSW 13 11,760,487 (GRCm39) missense probably damaging 0.98
R5518:Ryr2 UTSW 13 11,702,795 (GRCm39) missense probably benign 0.01
R5571:Ryr2 UTSW 13 11,570,334 (GRCm39) missense possibly damaging 0.91
R5591:Ryr2 UTSW 13 11,609,900 (GRCm39) missense probably benign 0.06
R5619:Ryr2 UTSW 13 11,723,088 (GRCm39) missense probably damaging 1.00
R5630:Ryr2 UTSW 13 11,616,691 (GRCm39) missense probably damaging 1.00
R5644:Ryr2 UTSW 13 11,610,468 (GRCm39) missense probably damaging 0.99
R5667:Ryr2 UTSW 13 11,774,722 (GRCm39) missense probably damaging 1.00
R5775:Ryr2 UTSW 13 11,784,848 (GRCm39) missense probably damaging 1.00
R5836:Ryr2 UTSW 13 11,618,618 (GRCm39) missense probably damaging 1.00
R5858:Ryr2 UTSW 13 11,575,460 (GRCm39) missense probably damaging 0.99
R5934:Ryr2 UTSW 13 11,599,040 (GRCm39) missense probably damaging 0.96
R5939:Ryr2 UTSW 13 11,805,218 (GRCm39) missense probably damaging 0.99
R5941:Ryr2 UTSW 13 11,702,788 (GRCm39) missense probably damaging 1.00
R5945:Ryr2 UTSW 13 11,675,008 (GRCm39) missense probably damaging 1.00
R5946:Ryr2 UTSW 13 11,741,839 (GRCm39) missense probably damaging 1.00
R5966:Ryr2 UTSW 13 11,677,124 (GRCm39) nonsense probably null
R5974:Ryr2 UTSW 13 11,729,397 (GRCm39) splice site probably null
R6104:Ryr2 UTSW 13 11,814,711 (GRCm39) missense probably damaging 1.00
R6118:Ryr2 UTSW 13 11,807,575 (GRCm39) missense possibly damaging 0.69
R6149:Ryr2 UTSW 13 11,683,903 (GRCm39) missense probably benign
R6208:Ryr2 UTSW 13 11,910,106 (GRCm39) missense probably benign 0.04
R6217:Ryr2 UTSW 13 11,848,964 (GRCm39) missense probably damaging 1.00
R6230:Ryr2 UTSW 13 11,674,993 (GRCm39) missense probably damaging 0.99
R6279:Ryr2 UTSW 13 11,695,885 (GRCm39) missense probably damaging 0.97
R6294:Ryr2 UTSW 13 11,894,382 (GRCm39) missense probably damaging 1.00
R6300:Ryr2 UTSW 13 11,695,885 (GRCm39) missense probably damaging 0.97
R6350:Ryr2 UTSW 13 11,776,282 (GRCm39) missense probably damaging 0.98
R6484:Ryr2 UTSW 13 11,677,269 (GRCm39) missense possibly damaging 0.90
R6489:Ryr2 UTSW 13 11,848,893 (GRCm39) missense probably benign 0.29
R6548:Ryr2 UTSW 13 11,683,707 (GRCm39) missense probably damaging 1.00
R6591:Ryr2 UTSW 13 11,609,609 (GRCm39) missense probably benign 0.01
R6623:Ryr2 UTSW 13 11,724,951 (GRCm39) missense probably damaging 1.00
R6649:Ryr2 UTSW 13 11,610,529 (GRCm39) missense probably damaging 0.99
R6691:Ryr2 UTSW 13 11,609,609 (GRCm39) missense probably benign 0.01
R6770:Ryr2 UTSW 13 11,753,348 (GRCm39) missense probably damaging 1.00
R6802:Ryr2 UTSW 13 11,701,852 (GRCm39) missense probably damaging 1.00
R6809:Ryr2 UTSW 13 11,741,816 (GRCm39) missense probably damaging 1.00
R6893:Ryr2 UTSW 13 11,844,540 (GRCm39) missense possibly damaging 0.75
R6911:Ryr2 UTSW 13 11,842,445 (GRCm39) missense possibly damaging 0.50
R6915:Ryr2 UTSW 13 11,760,487 (GRCm39) missense probably damaging 1.00
R6943:Ryr2 UTSW 13 11,581,834 (GRCm39) missense possibly damaging 0.92
R6960:Ryr2 UTSW 13 11,816,129 (GRCm39) missense probably benign 0.28
R6997:Ryr2 UTSW 13 11,669,266 (GRCm39) missense possibly damaging 0.88
R6998:Ryr2 UTSW 13 11,727,052 (GRCm39) missense probably damaging 0.99
R7001:Ryr2 UTSW 13 11,809,491 (GRCm39) missense probably damaging 0.98
R7047:Ryr2 UTSW 13 11,839,286 (GRCm39) missense possibly damaging 0.64
R7089:Ryr2 UTSW 13 11,664,662 (GRCm39) missense probably benign 0.10
R7125:Ryr2 UTSW 13 11,684,873 (GRCm39) missense probably damaging 0.99
R7127:Ryr2 UTSW 13 11,670,599 (GRCm39) missense probably damaging 1.00
R7131:Ryr2 UTSW 13 11,683,697 (GRCm39) critical splice donor site probably null
R7131:Ryr2 UTSW 13 11,655,213 (GRCm39) missense possibly damaging 0.63
R7159:Ryr2 UTSW 13 11,825,794 (GRCm39) missense probably damaging 0.99
R7174:Ryr2 UTSW 13 11,816,063 (GRCm39) missense possibly damaging 0.81
R7180:Ryr2 UTSW 13 11,701,864 (GRCm39) missense probably damaging 1.00
R7182:Ryr2 UTSW 13 11,774,643 (GRCm39) missense probably benign
R7189:Ryr2 UTSW 13 11,898,009 (GRCm39) missense probably damaging 1.00
R7241:Ryr2 UTSW 13 11,680,799 (GRCm39) missense possibly damaging 0.71
R7244:Ryr2 UTSW 13 11,612,032 (GRCm39) missense probably damaging 1.00
R7326:Ryr2 UTSW 13 11,753,080 (GRCm39) missense possibly damaging 0.95
R7331:Ryr2 UTSW 13 11,760,517 (GRCm39) missense probably benign
R7365:Ryr2 UTSW 13 11,655,161 (GRCm39) missense probably damaging 0.99
R7372:Ryr2 UTSW 13 11,695,885 (GRCm39) missense probably damaging 0.97
R7395:Ryr2 UTSW 13 11,799,997 (GRCm39) missense probably damaging 0.98
R7404:Ryr2 UTSW 13 11,750,506 (GRCm39) missense probably damaging 0.97
R7417:Ryr2 UTSW 13 11,571,634 (GRCm39) splice site probably null
R7425:Ryr2 UTSW 13 11,720,530 (GRCm39) missense probably benign 0.20
R7444:Ryr2 UTSW 13 11,570,349 (GRCm39) missense probably benign 0.25
R7456:Ryr2 UTSW 13 11,767,168 (GRCm39) missense probably benign
R7460:Ryr2 UTSW 13 11,720,596 (GRCm39) missense probably benign 0.10
R7474:Ryr2 UTSW 13 11,609,762 (GRCm39) missense probably benign 0.04
R7543:Ryr2 UTSW 13 11,653,317 (GRCm39) critical splice donor site probably null
R7549:Ryr2 UTSW 13 11,752,871 (GRCm39) missense probably benign 0.15
R7558:Ryr2 UTSW 13 11,814,711 (GRCm39) missense probably damaging 1.00
R7565:Ryr2 UTSW 13 11,575,539 (GRCm39) missense possibly damaging 0.84
R7627:Ryr2 UTSW 13 11,776,213 (GRCm39) missense possibly damaging 0.65
R7698:Ryr2 UTSW 13 11,776,201 (GRCm39) missense possibly damaging 0.94
R7702:Ryr2 UTSW 13 11,705,219 (GRCm39) missense probably damaging 0.99
R7719:Ryr2 UTSW 13 11,745,229 (GRCm39) missense possibly damaging 0.94
R7772:Ryr2 UTSW 13 11,765,897 (GRCm39) missense probably benign
R7797:Ryr2 UTSW 13 11,816,066 (GRCm39) missense probably damaging 0.99
R7829:Ryr2 UTSW 13 11,842,493 (GRCm39) missense possibly damaging 0.81
R7855:Ryr2 UTSW 13 11,721,509 (GRCm39) nonsense probably null
R7872:Ryr2 UTSW 13 11,610,610 (GRCm39) missense probably damaging 1.00
R7908:Ryr2 UTSW 13 11,807,634 (GRCm39) missense probably benign 0.01
R7929:Ryr2 UTSW 13 11,609,680 (GRCm39) missense probably damaging 1.00
R7929:Ryr2 UTSW 13 11,705,181 (GRCm39) nonsense probably null
R7952:Ryr2 UTSW 13 11,661,313 (GRCm39) splice site probably null
R8008:Ryr2 UTSW 13 11,671,980 (GRCm39) missense probably benign 0.30
R8011:Ryr2 UTSW 13 11,603,026 (GRCm39) critical splice donor site probably null
R8097:Ryr2 UTSW 13 11,960,881 (GRCm39) missense probably damaging 0.98
R8133:Ryr2 UTSW 13 11,618,584 (GRCm39) missense probably damaging 1.00
R8253:Ryr2 UTSW 13 11,842,439 (GRCm39) missense possibly damaging 0.94
R8278:Ryr2 UTSW 13 11,610,392 (GRCm39) nonsense probably null
R8351:Ryr2 UTSW 13 11,814,718 (GRCm39) missense probably damaging 0.98
R8401:Ryr2 UTSW 13 11,683,821 (GRCm39) missense possibly damaging 0.95
R8403:Ryr2 UTSW 13 11,699,364 (GRCm39) missense possibly damaging 0.95
R8431:Ryr2 UTSW 13 11,673,894 (GRCm39) missense probably benign 0.00
R8509:Ryr2 UTSW 13 11,592,664 (GRCm39) critical splice donor site probably null
R8551:Ryr2 UTSW 13 11,575,479 (GRCm39) missense possibly damaging 0.93
R8684:Ryr2 UTSW 13 11,702,875 (GRCm39) missense probably damaging 0.99
R8735:Ryr2 UTSW 13 11,701,833 (GRCm39) missense probably damaging 0.97
R8766:Ryr2 UTSW 13 11,683,855 (GRCm39) missense probably damaging 0.97
R8817:Ryr2 UTSW 13 11,750,509 (GRCm39) missense possibly damaging 0.95
R8827:Ryr2 UTSW 13 11,572,934 (GRCm39) missense possibly damaging 0.80
R8884:Ryr2 UTSW 13 11,794,152 (GRCm39) missense probably benign 0.19
R8889:Ryr2 UTSW 13 11,799,990 (GRCm39) missense probably damaging 0.99
R8891:Ryr2 UTSW 13 11,814,768 (GRCm39) missense probably damaging 1.00
R8979:Ryr2 UTSW 13 11,609,924 (GRCm39) missense probably benign 0.00
R9013:Ryr2 UTSW 13 11,618,618 (GRCm39) missense probably damaging 0.98
R9040:Ryr2 UTSW 13 11,609,672 (GRCm39) missense probably damaging 0.97
R9044:Ryr2 UTSW 13 11,752,989 (GRCm39) nonsense probably null
R9056:Ryr2 UTSW 13 11,610,817 (GRCm39) missense possibly damaging 0.94
R9084:Ryr2 UTSW 13 11,616,724 (GRCm39) missense probably damaging 1.00
R9113:Ryr2 UTSW 13 11,618,741 (GRCm39) intron probably benign
R9116:Ryr2 UTSW 13 11,587,185 (GRCm39) missense possibly damaging 0.93
R9125:Ryr2 UTSW 13 11,669,292 (GRCm39) missense probably benign 0.28
R9148:Ryr2 UTSW 13 11,900,424 (GRCm39) missense probably benign 0.02
R9210:Ryr2 UTSW 13 11,844,560 (GRCm39) missense probably damaging 0.99
R9212:Ryr2 UTSW 13 11,844,560 (GRCm39) missense probably damaging 0.99
R9233:Ryr2 UTSW 13 11,610,772 (GRCm39) missense possibly damaging 0.77
R9254:Ryr2 UTSW 13 11,898,002 (GRCm39) missense probably damaging 1.00
R9262:Ryr2 UTSW 13 11,765,854 (GRCm39) missense probably damaging 0.97
R9275:Ryr2 UTSW 13 11,897,976 (GRCm39) missense probably benign 0.10
R9278:Ryr2 UTSW 13 11,897,976 (GRCm39) missense probably benign 0.10
R9309:Ryr2 UTSW 13 11,721,578 (GRCm39) missense probably damaging 0.99
R9379:Ryr2 UTSW 13 11,898,002 (GRCm39) missense probably damaging 1.00
R9409:Ryr2 UTSW 13 11,695,973 (GRCm39) missense probably damaging 0.99
R9429:Ryr2 UTSW 13 11,809,459 (GRCm39) missense probably damaging 0.97
R9445:Ryr2 UTSW 13 11,787,463 (GRCm39) missense probably damaging 1.00
R9464:Ryr2 UTSW 13 11,752,680 (GRCm39) missense probably benign 0.00
R9467:Ryr2 UTSW 13 11,571,490 (GRCm39) missense possibly damaging 0.70
R9546:Ryr2 UTSW 13 11,602,101 (GRCm39) critical splice donor site probably null
R9562:Ryr2 UTSW 13 11,760,104 (GRCm39) missense probably damaging 1.00
R9609:Ryr2 UTSW 13 11,683,848 (GRCm39) missense probably damaging 1.00
R9704:Ryr2 UTSW 13 11,737,646 (GRCm39) missense probably damaging 1.00
R9764:Ryr2 UTSW 13 11,701,935 (GRCm39) missense possibly damaging 0.67
R9772:Ryr2 UTSW 13 11,609,785 (GRCm39) missense probably benign 0.13
R9776:Ryr2 UTSW 13 11,707,599 (GRCm39) missense probably damaging 0.98
S24628:Ryr2 UTSW 13 11,884,042 (GRCm39) missense probably damaging 0.97
X0019:Ryr2 UTSW 13 11,718,387 (GRCm39) missense probably benign 0.04
Z1176:Ryr2 UTSW 13 11,658,689 (GRCm39) critical splice donor site probably null
Z1176:Ryr2 UTSW 13 11,613,497 (GRCm39) critical splice acceptor site probably null
Z1176:Ryr2 UTSW 13 11,809,435 (GRCm39) nonsense probably null
Z1177:Ryr2 UTSW 13 11,765,759 (GRCm39) missense possibly damaging 0.87
Predicted Primers PCR Primer
(F):5'- GTGAAACTGGTGATTCCCCATTC -3'
(R):5'- GCATTTGCTGAAGACCTCTAAGG -3'

Sequencing Primer
(F):5'- GGTGATTCCCCATTCAAAAAGTGC -3'
(R):5'- CAACAACCTGCCTTGTACT -3'
Posted On 2016-07-06